Check if You Are Naturally Immune to HIV (Via 23andme Results)

Hip

Hip

Senior Member
Messages
18,117
Something interesting for those who have their 23andme.com genetic results:

1% of the population have genetic immunity (high resistance) to the most common strains of HIV: these HIV-immune individuals are those who carry two copies of the genetic mutation called CCR5 Delta32.

To check if you have this genetic immunity to HIV, click ➤ HERE.

This will take you to the appropriate webpage on 23andme.com, where you can see how many copies of this CCR5 Delta32 mutation you have.

On that webpage, you will see this:

Gene · · · Position· · · SNP · · · · Versions· · · Your Genotype
CCR5 · · · 46414947· · · i3003626· · · · · · · · · ???

If your genotype is DD, then you have immunity / resistance to HIV.
If your genotype is II or DI then you are not resistant to HIV infection.


More specifically:
• If your genotype is II then you have no copies of the CCR5 Delta32 mutation, and are not resistant to HIV infection.
• If your genotype is DI then you have one copy of the CCR5 Delta32 mutation, are not resistant to HIV infection, but may have slower progression to AIDS after infection. Around 10% of Caucasians have one copy of CCR5 Delta32.
• If your genotype is DD then you have two copies of the CCR5 Delta32 mutation, and are resistant to infection by the most common strain of HIV people usually encounter, though protection is not complete. Around 1% of Caucasians have two copies of CCR5 Delta32.


UPDATE: 23andme have changed the way they present this HIV resistance data. To see if you are resistant to HIV or not, see the instructions on this page.


Notes:
The CCR5 Delta32 mutation has the RSID of rs333. However 23andme call this mutation i3003626.

Some Links:
• I3003626 - SNPedia
• Rs333 - SNPedia
• CCR5 - SNPedia

• HIV Resistant Mutation
• New Drugs to Grant Natural Resistance or Even Immunity Against HIV/AIDS Show Encouraging Results
• SNPedia: All I want for Christmas is a cure for HIV
• "Immune" to HIV? Not So Fast


This article on the 23andme blog is also interesting, and details CCR5 Delta32, plus three more SNPs that affect the rate of HIV disease progression.
 
Last edited:
justy

justy

Donate Advocate Demonstrate
Messages
5,524
Location
U.K
I think though we may also need to take into account that we may already have compromised immune systems which would in fact make chances of contracting a disease such as HIV much higher in our population.

Interesting though.
 
Hip

Hip

Senior Member
Messages
18,117
justy said:
I think though we may also need to take into account that we may already have compromised immune systems which would in fact make chances of contracting a disease such as HIV much higher in our population.

Interesting though.
Click to expand...

Well, if the fact that ME/CFS patients rarely catch colds is anything to go by (and Rich Van K said he thought this was because type I interferons may be constantly active in ME/CFS, instantly neutralizing any cold viruses as soon as they hit), ME/CFS patients might conceivably also be less prone to catching HIV — but I have no plans to test this theory!


Interesting how it says here that an HIV-positive patient, who received a bone marrow transplant from a donor with 2 copies of the CCR5 Delta32 HIV-resistance mutation, was cured of his HIV infection. The researchers concluded that this "SNP transplant" cured their patient's HIV.


This reminds me of a study (details posted here), where mice with chronic coxsackievirus B infection (arguably the virus most strongly linked to ME/CFS) were injected with B cells from mice immune to coxsackievirus B, and in many cases this resulted in the elimination of the infection.

This makes me wonder whether there are humans who are naturally resistant to coxsackievirus B by their genetic makeup, and if so, would an injection of their B-cells also eliminate the coxsackievirus B infection in ME/CFS patients, thus curing ME/CFS?
 
Last edited:
justy

justy

Donate Advocate Demonstrate
Messages
5,524
Location
U.K
Hi Hip, I think you need to be a bit careful throwing the word 'fact' around. It is not a fact that all PWME/CFS rarely catch colds. Many of us do indeed catch everything going - especially perhaps earlier in the illness. I think some have a distinctly lowered immunity and propensity to catch things and an inability to clear viruses/bacteria/fungal infections.

Those pesky B cells keep cropping up everywhere don't they?

Justy
 
Hip

Hip

Senior Member
Messages
18,117
You are right, Justy, a lot of people with ME/CFS do say that they rarely ever catch colds anymore, suggesting that certain aspects of the immune system are ramped up; but perhaps there is also a group of ME/CFS patients who are more susceptible to catching colds.
 
Last edited:
A

Azrael

Messages
83
Interesting stuff indeed and I can tell you that im also one of them that very rarely catches a cold. I can't even remember when my last was.

Ofcourse apart from my constant runny nose :oops:
 
M

Maalesh

Messages
1
23&Me may have changed the formatting of their report - but for my genotype, it doesn't show DD, DI or II. It shows:

GTCAGTATCAATTCTGGAAGAATTTCCAGACA/GTCAGTATCAATTCTGGAAGAATTTCCAGACA

Not sure if this means that I have 2 copies of the mutation, or something else entirely.
 
Critterina

Critterina

Senior Member
Messages
1,238
Location
Arizona, USA
Maalesh said:
23&Me may have changed the formatting of their report - but for my genotype, it doesn't show DD, DI or II. It shows:

GTCAGTATCAATTCTGGAAGAATTTCCAGACA/GTCAGTATCAATTCTGGAAGAATTTCCAGACA

Not sure if this means that I have 2 copies of the mutation, or something else entirely.
Click to expand...
Did you put i3003626 in the SNP search? Use the pull-down menu by your name to select 'browse raw data' and the box on the right says SNP - paste it there.
 
You must log in or register to reply here.
Back