Check if You Are Naturally Immune to HIV (Via 23andme Results)

ScottTriGuy

Stop the harm. Start the research and treatment.
Messages
1,397
Likes
5,671
Location
Toronto, Canada
"DI" (slower disease progression), but also Duffy-positive (faster disease progression).

It took almost 4 years after HIV infection before my CD4s dipped below 200. At that time, that was the threshold for medication initiation.
 
Messages
8
Likes
18
Mine also shows
GTCAGTATCAATTCTGGAAGAATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA

and I typed in i3003626 in the search box. The variants listed are

— or GTCAGTATCAATTCTGGAAGAATTTCCAGACA.

Interesting...
 
Messages
3,444
Likes
5,331
Location
USA
variant is : — or GTCAGTATCAATTCTGGAAGAATTTCCAGACA

mine is GTCAGTATCAATTCTGGAAGAATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA

What??????? does it mean?
 

Valentijn

Senior Member
Messages
15,786
Likes
45,658
"-" would be a deletion, and the long string of letters would be the insertion.

Approximately 4% of people are heterozygous for the deletion, and none in a sample of 101 people (multiple ethnicities) are homozygous for the deletion.
 
Messages
1
Likes
0
With the new chip the translation is as following:
GTCAGTATCAATTCTGGAAGAATTTCCAGACA/GTCAGTATCAATTCTGGAAGAATTTCCAGACA = II
-/GTCAGTATCAATTCTGGAAGAATTTCCAGACA = DI

-/- = DD
 

pattismith

Senior Member
Messages
3,148
Likes
5,967
I wonder is CCR5 deletion is linked to increased CD8, and if the deletion protects against severe covid...

Maybe CCR5 inhibitors could be helpful for ME/CFS? (There is a plant with this ability)

CCR5 inhibition in critical COVID-19 patients decreases inflammatory cytokines, increases CD8 T-cells, and decreases SARS-CoV2 RNA in plasma by day 14
https://doi.org/10.1016/j.ijid.2020.10.101Get rights and content


Highlights


Anti-CCR5 humanized monoclonal antibody restored CD8 counts in COVID patients.

Inversely correlated with decreases in plasma viral load (pVL) by day 14.

CCL5/RANTES up 3–5-fold in mild/moderate patients and >100-fold in critical ones.

First report of highly sensitive, quantitative pVL by ddPCR in COVID patients.

Statistically significant drop in IL-6 by day 14 of treatment.

Abstract

Objective

Infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is now a global pandemic. Emerging results indicate a dysregulated immune response. Given the role of CCR5 in immune cell migration and inflammation, we investigated the impact of CCR5 blockade via the CCR5-specific antibody leronlimab on clinical, immunological, and virological parameters in severe COVID-19 patients.

Methods

In March 2020, 10 terminally ill, critical COVID-19 patients received two doses of leronlimab via individual emergency use indication. We analyzed changes in clinical presentation, immune cell populations, inflammation, as well as SARS-CoV-2 plasma viremia before and 14 days after treatment.

Results

Over the 14-day study period, six patients survived, two were extubated, and one discharged. We observed complete CCR5 receptor occupancy in all donors by day 7. Compared with the baseline, we observed a concomitant statistically significant reduction in plasma IL-6, restoration of the CD4/CD8 ratio, and resolution of SARS-CoV2 plasma viremia (pVL). Furthermore, the increase in the CD8 percentage was inversely correlated with the reduction in pVL (r = −0.77, p = 0.0013).

Conclusions

Our study design precludes clinical efficacy inferences but the results implicate CCR5 as a therapeutic target for COVID-19 and they form the basis for ongoing randomized clinical trials.
 
Messages
1,755
Likes
4,489
Location
U.S., Earth
@Hip it's interesting to note CCR5 deletion is protective for enterovirus infection but associated with worse outcome in influenza.

Beyond HIV infection: Neglected and varied impacts of CCR5 and CCR5Δ32 on viral diseases (nih.gov)
I'm not so sure about that. That was only one German study, and CCR5 deletions are known to increase susceptibility to almost every infection except for HIV.

CCR5 is a necessary receptor for attracting T cells to the site of infection.

Since CCR5 is required by the HIV virus to infect cells, the CCR5 deletion protects people from becoming infected with HIV.

But the CCR5 deletion slows down the immune response to infections in general.
 
Last edited:
Messages
1,755
Likes
4,489
Location
U.S., Earth
I wonder is CCR5 deletion is linked to increased CD8, and if the deletion protects against severe covid...
Here's another paper that suggests that the CCR5 deletion reduces the severity of COVID:

The CCR5-delta32 variant might explain part of the association between COVID-19 and the chemokine-receptor gene cluster (Gomez et al., 2020)
https://www.medrxiv.org/content/10.1101/2020.11.02.20224659v1.full.pdf

Excerpt:
Gomez et al 2020 said:
We found a significantly lower frequency of CCR5-Δ32 among the COVID-19 patients. ... The difference was mainly due to the reduced frequency of CCR5-Δ32 carriers in the severe [patients], significantly lower than in the non-severe patients.
So the CCR5 deletion prevents the immune system from initiating severe inflammation. In that sense, a CCR5 deletion can protect against severe COVID, but only by slowing down the immune system.