Lapp Reports XMRV is Found in CFS Using Genome Detection Technology/Ampligen News

[Cort]

Dr. Lapp reports from the Hemispherx Biopharma meeting

This was quite a stunning report. It starts off by saying that he suspects "that information relayed this past week to us will change the field of medicine forever"..You don't hear that very often!

He reports that the MLV's Lo found are similar enough to the XMRV the WPI found to warrant their being included in the same group - that is definitely a matter of contention.

He also reports that XMRV kills cells - which I don't think we've heard yet- but maybe he has some inside information (or I have missed something). (Actually the technology reported below requires that the cells have died..)

The interesting part comes from a report from Dr. Urnovitz of Chronix Biomedical Labs. Chronix has developed an incredibly quick and inexpensive way of mapping the entire genome which he reported will be available soon. When cells die they spill their guts into the bloodstream...its these sequences that Dr. Urnovits technology is looking for. When they looked in the blood of some CFS patients hey were able to pick out 'chimeras' made up of XMRV genes (but oddly missing their LTR regions).

This is really new technology....and it remains to be seen how it will be accepted. Dr. Urnovitz has run several labs over the past 30 years. He's published 3 papers over that time that I could find...

http://www.drlapp.net/meLetterMar2011.htm

XMRV & AMPLIGEN
A Report from the 9th Hemispherx Biopharma Investigators Meeting
March 3-6, 2011
Gene Sequencing in Persons with CFS
XMRV Subset Analysis and Ampligen Treatment
What Is Ampligen?


Gene Sequencing in Persons with CFS
Wendy Fallick, our research coordinator, and I have just returned from the 9th Investigators Meeting sponsored by Hemispherx Biopharma, makers of Ampligen and Alferon. This was perhaps the most exciting of these meetings that I have attended, and I suspect that information relayed this past week to us will change the field of medicine forever. I want to share that information with you.

Recall that Lombardi, Mikovits, et alia published a paper in the October 2009 Science journal describing a novel retrovirus in 67% of 101 patients with CFS, using a PCR (polymerase chain reaction) test. By checking for antibodies, viral protein, and direct viral culture they were able to demonstrate this virus in 95-98% of PWCs (persons with CFS).

This virus was called XMRV because of its special characteristics: Xenotropic because it first developed in another animal species but now infected only humans; Murine because it first developed in mice; and RetroVirus because it replicated backwards unlike most other viruses. In fact, XMRV was related to a family of murine leukemia viruses, or MLVs.

The Science paper was followed by several other reports that the virus was not found in other cohorts, and confidence in the Lombardi-Mikovits report was waning. Then Drs. Lo and Alter published a 2010 paper that identified by PCR a similar retrovirus in 86.5% of persons with CFS that they had studied. The viruses that they identified were MLVs, only 2-3 base pairs (.00025 %) different from Lombardi’s XMRV.

This difference has been explained as a “shift” in the genome attributed to time and distance. That is, over time viruses tend to mutate slightly, and it is not exceptional for viruses from one geographical region (Lombardi/Mikovits on the West Coast) to differ slightly from those in another region (Lo/Alter, East Coast). This was seen, for example, in the 2009 swine flu epidemic where over 50 different strains of H1N1 were identified from Hong Kong, Singapore, Malaysia, etc.

There are two retroviruses thought to be pathogenic in man:

HTLV Human T-Lymphotrophic Virus (4 strains but only 1 is harmful to man)

HIV Human Immunodeficiency Virus (2 strains but only one causes AIDS)

And now we have to add MRVs or MLVs (Murine Retroviruses or Murine Leukemia Viruses) to the list. There are several strains of MLVs of which XMRV is one strain. Which strains are pathogenic in man has not yet been determined, although XMRV has been linked to familial prostate cancer at the least.

Let’s turn for a second to a schematic representation of DNA and XMRV. DNA is made up of two twisted strands of nucleic acids strung together like beads. Only 4 nucleic acids are involved: Adenine, Cytosine, Guanine, and Thymine – or A,C.G and T – and their pattern along a single strand of DNA might look like :

ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

XMRV is an RNA virus, or strand of nucleotide sequences very much like a single strand of DNA. Sections of each strand are named for their specific functions. A strand of XMRV may be represented as :




5’ 3’



Notice that there is a head (“five prime”) and a tail (“three prime”) and both ends are marked by a section called the “long terminal repeat” or LTR.

Most viruses replicate themselves starting from the 5’end to the 3’ end. Retroviruses, however, use “reverse transcriptase (RT)” to replicate backwards (retro) inside a host cell to form a strand of DNA. This strand then incorporates itself into the host’s own genomic DNA by an enzyme called “integrase.”

Thus human DNA +XMRV ends up looking like:

ACGTACGTACGTACGT-LTR-US-gag-pol-env-U3-LTR-CGTACGTACGTACGTACGT

This new combination DNA is called a “chimera.” Now human DNA contains millions of nucleotides, and XMRV only contains about 8000 nucleotides, so the chimera is not as easy to spot as it appears here

Incorporated into your genome like this the virus may take control of the cell, manufacture abnormal proteins, and – in the case of XMRV – kill the cell. This latter event is called “apoptosis.”

Lastly, unlike the HIV retrovirus that multiplies rapidly and millions can be found in a single drop of blood, XMRV replicates slowly and is present in only very small amounts in the peripheral blood.

These characteristics of XMRV can explain several observations:

Very few XMRV particles are found in a blood sample and it may take multiple samples to find them

Inside the cell and/or chimera, the XMRV is relatively protected from detection by the immune system and many blood tests

When PWCs are very sick their white blood cell populations decrease (due to apoptosis)

The XMRV particle is so small it can infiltrate virtually any part of the body and any system

Why researchers are finding abnormal proteins in the blood and CSF of PWCs (proteomics)

Now, here is the most intriguing part of our Hemispherx meeting. It took hundreds of scientists at multiple sites ten years to map out the 3 billion nucleotides in the normal human genome. Dr. Carter introduced us to Howard Urnovitz, CEO of Chronix Biomedical. Urnovitz revealed that his research group is able to map genomes at a very rapid pace. He expects that in the near future, Chronix will be able to map your entire genome in under six hours and for probably less than a $100 fee. This is StarTrek medicine!

Urnovitz went on to explain that when apoptosis occurs, chimeras are spilled into the blood stream and can be extracted easily by his laboratory. When his lab examined the genomes of persons with CFS they found chimeras made up of XMRV genes (but oddly missing their LTR regions).

This technology is wonderful news for PWCs because if XMRV or MLV can be clearly shown to cause CFS, then we will have an inexpensive and unique marker for the disorder!

The Chronix test is not currently available commercially, but Hemispherx plans to explore the use of this technology in future studies.

 

[Cort]

Chronix Biomedical

On March 3rd Hemispherx and Chronix teamed together to file a joint patent for a blood test to diagnose CFS.

http://chronixbiomedical.com/

It's an interesting approach - as Urnovitz says they are looking dying and damaged cells - which would seem to be a good thing to focus in disease . They do seem to have short track record doing this with a few other disorders (cancer). I'm surprised, though, that he hasn't published any papers using their technology. It is very new technology, though. Maybe there hasn't been time.

CHRONIX BIOMEDICAL AND HEMISPHERX BIOPHARMA JOINTLY FILE PATENT APPLICATION FOR A BLOOD TEST FOR CHRONIC FATIGUE SYNDROME (CFS)

— HEMISPHERX AND CHRONIX PLAN STUDIES TO VALIDATE TECHNOLOGY AS A POTENTIAL DIAGNOSTIC TEST FOR CFS —

San Jose, CA March 3, 2011 – Chronix Biomedical ("Chronix") announced today that it filed a provisional United States patent application jointly with Hemispherx Biopharma, Inc. (NYSE Amex:HEB) ("Hemispherx") on a blood test for Chronic Fatigue Syndrome (“CFS”). Patients with CFS exhibit a wide range of disabling symptoms including the inability to overcome fatigue by rest, swollen lymph nodes and cognitive deficiencies. CFS is estimated to affect approximately 4 million Americans, according to the Centers for Disease Control and Prevention (CDC). The disorder has a negative economic impact in the United States estimated at more than $9 billion annually.

The Chronix experimental approach analyzes fragments of DNA often released into the bloodstream during the process of apoptosis or programmed cell death. Chronix is using its proprietary technology and advanced DNA sequencing platforms to measure alterations in specific regions of the chromosome, which can be detected as distinctive “signatures” in cell-free blood-borne DNA. By focusing on these signatures, Chronix’s technology can detect the presence of disease-damaged cells in simple blood samples without needing to biopsy diseased cells or tissues.

“Our technology—based on DNA released into the bloodstream by dying and damaged cells—taps into the dynamic information provided by the genomic alterations unique to each diseased cell. We capture what is happening to the DNA very early in and throughout the disease process, in real time, and patient by patient. That’s how our approach differs from other tests that focus on static genomic data or protein biomarkers,” said Dr. Urnovitz.

The patient-unique signatures captured by the Chronix technology may prove useful as a companion diagnostic – a test that is used to help guide treatment decisions – and to provide information about the disease process to help pharmaceutical companies select the most efficacious drug candidates.

Use of the Chronix diagnostic technology in CFS will be evaluated in a study being planned by Chronix and Hemispherx, a leader in CFS pharmaceutical research. Dr. William Carter, Hemispherx CEO, commented, “It is with great enthusiasm that we will be conducting studies aimed at validating the utility of the Chronix technology to identify how different individuals can respond to Hemispherx’s experimental drug Ampligen.”

The Chronix Biomedical blood test for Chronic Fatigue Syndrome is experimental in nature and has not been evaluated by any regulatory agency. It is currently limited to investigational use.

About Chronix Biomedical

Chronix Biomedical is pioneering a breakthrough approach to the diagnosis, monitoring and management of a broad range of cancers and other conditions. It has developed proprietary technology that measures and categorizes DNA sequences circulating in the blood that are associated with specific changes in disease and health status. Using advanced genome analysis methodology, proprietary data tools and disease-specific databases, Chronix has demonstrated the utility of its diagnostic and prognostic approach in a chronic neurologic disease, in breast and prostate cancer and in multiple myeloma. It is currently conducting studies in other cancers. The company initially plans to offer an Apoptotic Serum DNA testing service to cancer clinical researchers “For Investigational Use Only” to track disease recurrence and monitor treatment. Chronix is headquartered in San Jose, California and has research facilities in Germany.

About Hemispherx Biopharma

Hemispherx Biopharma, Inc. is an advanced specialty pharmaceutical company engaged in the manufacture and clinical development of new drug entities for treatment of seriously debilitating disorders. Hemispherx’s flagship products include Alferon N Injection (FDA approved for a category of sexually transmitted diseases) and the experimental therapeutics Ampligen and Alferon LDO. Ampligen is an experimental RNA nucleic acid being developed for globally important debilitating diseases and disorders of the immune system. Hemispherx’s platform technology includes components for potential treatment of various severely debilitating and life threatening diseases. Hemispherx has patents comprising its core intellectual property estate and a fully commercialized product (Alferon N Injection). The Company wholly owns and exclusively operates a GMP certified manufacturing facility in the United States for commercial products. For more
information please visit www.hemispherx.net.

 

[serg1942]

Wow! Thanks Cort!!! Fantastic and hope it turns out to be truth!

 

[Cort]

Check out Dr. Lapps over view of Ampligen and particularly his quite emotional statement at the end. He's clearly tired of the delays approving Ampligen.

Its encouraging that Ampligen was deemed 'approvable' but more study was needed.

Check out all the things it can do to the immune system as well!

Lapp reports that 1/3rd of patients receive very significant global improvement - which is fantastic....the next step is figuring out who gets better from it.

What Is Ampligen?

Ampligen is a poly-nucleic acid medication that has been studied for over two decades, but not yet FDA-approved for treating any disorder. It was found in the 1980s to be effective in treating Chronic Fatigue Syndrome symptoms, and subsequently underwent several trials in the US and abroad. Based on these results a new drug application was filed with the FDA in 2009, and in December of that year their Complete Letter of Response indicated that Ampligen was approvable but requested that more subjects be treated to assure safety and efficacy.

So far over 90,000 doses of Ampligen have been administered to over 900 subjects.

Ampligen has unique properties. It is a selective Toll Receptor (TLR3) agonist with immunomodulatory, anti-proliferative, and anti-viral properties. The drug:

• Increases interferon a and b
• Restores TH2 immunity to the (more normal) TH1 type
• Activates the immune response (e.g., against HIV and renal carcinoma)
• Increases LAK and NK Cell activity
• Induces dendritic cell maturation (thus IgA and some IgG)
• Increases macrophage activity
• Restores delayed-type hypersensitivity
• Has antiviral effects versus retroviruses, HHV6, and RNA viruses.

This drug is administered intravenously twice weekly for at least 6 months. Side effects are mostly flu-like in nature, and overall the drug has been tolerated extremely well. While Ampligen is not considered a cure for CFS, published studies have demonstrated improvement in duration of exercise on a treadmill and a reduction in use of concomitant medications. Actuarial studies suggest that Ampligen treatment saves about $5000 per year in medical expenses.

Dr. Lapp has been involved with Ampligen studies since 1988, and our personal experience at Hunter-Hopkins with the current AMP-511 study has been that about one third of subjects achieve very significant global improvement.

Ampligen is currently available only at Hunter-Hopkins and Dr. Petersons Lake Tahoe clinic. Dr. Batemans Fatigue Consultation Clinic in Salt Lake City will soon resume treatments, and Hemispherx is planning to add several other sites around the US, in addition to sites in Mexico and Argentina.

For more information check out our website ( www.drlapp.net > Research > Ampligen), Clinical Trials (http://clinical trials.gov > search for study NCT00215813), and the Hemispherx Biopharma website at www.hemispherx.net. For application to the AMP-511 Cost Recovery Study, contact our research coordinator, Wendy Fallick, at 704 5439692.

Because AMP-511 is a treatment protocol and not a drug study, insurance may cover some or all of the expenses involved.

We owe a great debt of gratitude to Dr. William Carter and Hemispherx Biopharma for developing Ampligen the only proposed treatment for CFS and supporting research in CFS for over 22 years. I know that Dr. Carter, his colleagues, and his company have experienced the same kind of humiliation and disdain that all of us involved with CFS have experienced, and it is a testament to their courage and determination that they have endured all these years when they could have abandoned CFS for more lucrative areas.

 

[XAND]

I have to delete this because is unpublished material, sorry... also not sure of its reliability...

 

[eric_s]

Seems we have heard about a number of diagnostic tests or biomarkers recently.

From IrsiCaixa, the University of Utah, the Judy Mikovits abstract for her presentation at the NYAS, the CSF study and this one. One of those must hopefully pan out...

 

[eric_s]

Lapp reports that 1/3rd of patients receive very significant global improvement - which is fantastic....the next step is figuring out who gets better from it.

There already was a study where they found that XMRV+ subjects improve more than XMRV- subjects.

 

[eric_s]

The link does not work, XAND.

 

[XAND]

Sorry, I decided to delete that, because I assume they deleted the link because is unpublished material, and I did not want to run the risk of ruin the publication of a good news research to be published...

 

[Bob]

So, if i've understood this correctly, the new technology has been able to detect both human DNA, and the XMRV DNA, in the blood.
And they detected XMRV 'chimeras', which means that the XMRV DNA was attached to human DNA, thus suggesting that it had integrated into the human chromosome.

Does anyone think that I've understood that right?


Here's the relevant section from the Hunter-Hopkins letter:

Urnovitz went on to explain that when apoptosis occurs, chimeras are spilled into the blood stream and can be extracted easily by his laboratory. When his lab examined the genomes of persons with CFS they found chimeras made up of XMRV genes (but oddly missing their LTR regions).

http://www.facebook.com/notes/hunte...ispherx-biopharma-investiga/10150166713330325

 

[LJS]

Now, here is the most intriguing part of our Hemispherx meeting. It took hundreds of scientists at multiple sites ten years to map out the 3 billion nucleotides in the normal human genome. Dr. Carter introduced us to Howard Urnovitz, CEO of Chronix Biomedical. Urnovitz revealed that his research group is able to map genomes at a very rapid pace. He expects that in the near future, Chronix will be able to map your entire genome in under six hours and for probably less than a $100 fee. This is StarTrek medicine!

This sounds like a quack. Six hours and $100... where is the data to support this almost unbelievable claim?

 

[richvank]

Hi, all.

It's a fact that apoptosis is increased in ME/CFS. There are published papers on this. It's also a fact that the level of cell-free DNA is higher in PWMEs/PWCs than in normal, healthy people, but not as high as in cancer patients. Dr. John McLaren Howard of Acumen Lab in the UK offers a test for cell-free DNA. He has noted that when apoptosis occurs normally, it is a programmed cell death, and the components of the cell are disassembled in an orderly way, so that the amount of cell-free DNA that arises is small. This is not the case in ME/CFS, and especially not in cancer.

I think it's very plausible that retroviruses could be reponsible for early cell death in ME/CFS, and if so, I think it's very plausible that their complementary DNA would show up in DNA fragments in the blood. I think this is very interesting work.

Best regards,

Rich

 

[insearchof]

So, if i've understood this correctly, the new technology has been able to detect both human DNA, and the XMRV DNA, in the blood.
And they detected XMRV 'chimeras', which means that the XMRV DNA was attached to human DNA, thus suggesting that it had integrated into the human chromosome.

Does anyone think that I've understood that right?


Here's the relevant section from the Hunter-Hopkins letter:

Bob

That was my understanding and reading of what was posted as well. Quite exciting news!

This is big news isn't it? Contaminants do not integrate into human DNA.

If this proves to be reliable, then this should put XMRV back up as a research agenda priority.....and maybe, the entire community can seize that moment to come together to demand government fund research into this area without further delays!

Ampligen seems to address many irregularities seen in PWC.

Thank you for posting this Cort.

 

[Overstressed]

Hi Rich,

very interesting what you say about apoptosis. I always thought that, when cells die, they shrink. It looks like that this virus contributes to early, and abnormal apoptosis.

Most likely, this happens with a similar mechanism as with HIV. With HIV, many CD4 cells die, without even being infected. So, retroviri are able to kill cells indirectly. I must say, I forgot which virus-protein was responsible for that.

Now, since I became ill I noticed that my nails changed, more particularly my lunulas(the half moon on your fingernails). The appeared and disappeared continuously and I always atrributed that to cell apoptosis, but since a month now, they don't disappear anymore. I guess, Gc-Maf is doing it's work and cell apoptosis is not happening anymore to full scale. Of course, that's just an assumption...

Thanks for the interesting information Cort and Rich!

OS.

 

[insearchof]

Hi Overstressed

What do you put the disappearance of the lunulas down to?

 

[Overstressed]

Hi insearchof,

I always suspected cell apoptosis, because if you look at another illness, sickle cell anemia, people's lunula disappear too. Since a month my lunulas are stable, stable in size and shape.

Take care,
OS.

 

[Enid]

Thanks Cort, This is just brilliant news - one feels all the hard work and research is coming together at last from the dedicated few. WOW !.

 

[beaker]

We owe a great debt of gratitude to Dr. William Carter and Hemispherx Biopharma for developing Ampligen the only proposed treatment for CFS and supporting research in CFS for over 22 years. I know that Dr. Carter, his colleagues, and his company have experienced the same kind of humiliation and disdain that all of us involved with CFS have experienced, and it is a testament to their courage and determination that they have endured all these years when they could have abandoned CFS for more lucrative areas.

http://www.cfs-news.org/kitei.htm

it's wise to remember who you are dealing with.

 

[garcia]

Hi, all.

It's a fact that apoptosis is increased in ME/CFS. There are published papers on this. It's also a fact that the level of cell-free DNA is higher in PWMEs/PWCs than in normal, healthy people, but not as high as in cancer patients. Dr. John McLaren Howard of Acumen Lab in the UK offers a test for cell-free DNA. He has noted that when apoptosis occurs normally, it is a programmed cell death, and the components of the cell are disassembled in an orderly way, so that the amount of cell-free DNA that arises is small. This is not the case in ME/CFS, and especially not in cancer.

I think it's very plausible that retroviruses could be reponsible for early cell death in ME/CFS, and if so, I think it's very plausible that their complementary DNA would show up in DNA fragments in the blood. I think this is very interesting work.

Best regards,

Rich

Rich, many thanks for posting this.
I have to say that I disagree that our cell-free DNA is lower than for cancer patients, at least for some of us. I had my cell-free DNA measured by Dr Howard and it came back at 35.0. My understanding is that cancer patients frequently have a cell-free dna of 30-40 (correct me if this is wrong).

I feel every bit as sick as a cancer patient.

 

[Esther12]

This sounds like a quack. Six hours and $100... where is the data to support this almost unbelievable claim?

Anyone know how credible this stuff is? I'm always suspicious of astounding scientific breakthroughs being promoted first to CFS patients. "In the near future" leaves quite a lot of wiggle room, and the technology in this area is shooting ahead... but still.

Hemispherx have made some bold claims previously, so I'm a bit suspicious of them... but maybe that's just how drug companies work. I don't know to what extent their trouble with the FDA is their fault or not... plenty of patients seem to have critical of them though.

It would be great to get some of this stuff published.