Is CFS not really a CNS disease?

[SWAlexander]

Just look at the multi-target of CNS. What symptoms appear when I go into detail about systhem malfunction.

 

[wabi-sabi]

I have the feeling we just don't know yet. People are finding things wrong with the CNS (brain) like Jarred Younger, but I'm not sure if anyone has figured out yet if that's a cause on an effect of something else.

And on a more meta-level, we currently understand ME/CFS as a multi-system disease. That could be very true- in that it's all over the body and not just in the CNS, even though it's partly in the CNS.

More research!

 

[BrightCandle]

I feel like we wont know until we both find something odd and then have something that works to treat it and then all the symptoms dissipate, only then will we have conclusive proof of the root of the condition. Until that moment all we have is some theories or treatments for part of the condition. Either that or something that appears in a blood/DNA/scan that conclusively shows a clear problem unique to the condition that could cause everything but for which there is no immediately obvious treament but even then until there is a treatment you can't be sure due to the systemic nature of the condition, it could always end up being a down stream consequence. So far at least neither scenario has happened, research is still moving forward quite slowly.

 

[SWAlexander]

I feel like we wont know until we both find something odd and then have something that works to treat it and then all the symptoms dissipate, only then will we have conclusive proof of the root of the condition. Until that moment all we have is some theories or treatments for part of the condition. Either that or something that appears in a blood/DNA/scan that conclusively shows a clear problem unique to the condition that could cause everything but for which there is no immediately obvious treament but even then until there is a treatment you can't be sure due to the systemic nature of the condition, it could always end up being a down stream consequence. So far at least neither scenario has happened, research is still moving forward quite slowly.

You are right. This is why I´m still looking in my DNA.
AND I found something odd: Thalassemia
People with the sickle cell mutation in both copies of the HBB gene produce proteins that clump together and lead to changes in the shape and behavior of red blood cells.
I have 2 mutation: CAGCCTAAGGGTGGGAAAATAGACC : Inactivation of an acceptor RNA splice site by a short deletion in beta-thalassemia
Thalassemia is an inherited blood disorder that causes your body to have less hemoglobin than normal. Hemoglobin enables red blood cells to carry oxygen. Thalassemia can cause anemia, leaving you fatigued.
What Are the Signs & Symptoms of Beta Thalassemia? tiredness. shortness of breath. a fast heartbeat. pale skin. yellow skin and eyes (jaundice) moodiness. slow growth.

 

[wabi-sabi]

Have you had a blood test for thalassemia? You'd think it would show up there if you had it.

 

[SWAlexander]

Have you had a blood test for thalassemia? You'd think it would show up there if you had it.

I have only my DNA that confirms the mutation. Unfortunately, 3 doctors don´t know how to order this test. I´m still trying to find another way to have a blood test.

 

[Shanti1]

I have only my DNA that confirms the mutation. Unfortunately, 3 doctors don´t know how to order this test. I´m still trying to find another way to have a blood test.

Thalassemia major (homozygous) is diagnosed early in life due to the very obvious changes on a CBC and the need for blood transfusions and major medical intervention. Thalassemia minor (heterozygous) can be missed until someone is older because people are usually pretty functional, but it will show up on a CBC as extremely low MCV without iron deficiency. Hemoglobin as often low, RBCs are typically normal or even elevated.
Here are classic labs for thalassemia minor:

 

[wabi-sabi]

@Shanti1
Sounds like in thalassemia simple, standard lab tests are out of whack enough that it's unlikely to be a missed diagnosis.

 

[Shanti1]

Sounds like in thalassemia simple, standard lab tests are out of whack enough that it's unlikely to be a missed diagnosis.

Yes, I think so. Even if not as extreme as the above, you should see similar trends.

 

[Pyrrhus]

Just look at the multi-target of CNS. What symptoms appear when I go into detail about systhem malfunction.

If you look at the picture, only the yellow parts represent the Central Nervous System (CNS).
The blue parts represent the Peripheral Nervous System (PNS).

And on a more meta-level, we currently understand ME/CFS as a multi-system disease. That could be very true- in that it's all over the body and not just in the CNS, even though it's partly in the CNS.

And remember that every system in the body is controlled by the nervous system, whether it's the CNS or the PNS. A disease that affects both the CNS and the PNS is, by necessity, going to be a multi-system disease.

 

[SWAlexander]

Thalassemia major (homozygous) is diagnosed early in life due to the very obvious changes on a CBC and the need for blood transfusions and major medical intervention. Thalassemia minor (heterozygous) can be missed until someone is older because people are usually pretty functional, but it will show up on a CBC as extremely low MCV without iron deficiency. Hemoglobin as often low, RBCs are typically normal or even elevated.
Here are classic labs for thalassemia minor:
View attachment 45043

Thank you.
these were the last tests:

 

[Shanti1]

@SWAlexander I don't see anything in the labs indicating thalassemia, but if you are thinking about your blood clots, I do remember seeing that many of the antibodies you had elevated on another lab are associated with increased clotting and antiphospholipid syndrome. Something to check in with your doc about if you haven't already.

 

[SWAlexander]

@SWAlexander I don't see anything in the labs indicating thalassemia, but if you are thinking about your blood clots, I do remember seeing that many of the antibodies you had elevated on another lab are associated with increased clotting and antiphospholipid syndrome. Something to check in with your doc about if you haven't already.

Have you considered FII Wildtype and FV wildtype (see blood test results - DNA confirmed) "Prothrombin G20210A is a genetic condition that increases the risk of blood clots including from deep vein thrombosis, and of pulmonary embolism?
Thanks. I think I´m a complete mess. Wonder how I made it this far.

 

[sometexan84]

No.

 

[Shanti1]

@SWAlexander "wildtype" means that you do not have the mutation.

 

[SWAlexander]

I just got tired of waiting for Dr´s to do something and ordered an extensive test for Mast Cell (MCAS) und Histaminintoleranz directly from a German Lab with a very good reputation.

 

[Shanti1]

@SWAlexander I hope you find some answers, I know it can be so frustrating and I'm sorry you have so many symptoms at once. We are all in your corner.