I feel like we wont know until we both find something odd and then have something that works to treat it and then all the symptoms dissipate, only then will we have conclusive proof of the root of the condition. Until that moment all we have is some theories or treatments for part of the condition. Either that or something that appears in a blood/DNA/scan that conclusively shows a clear problem unique to the condition that could cause everything but for which there is no immediately obvious treament but even then until there is a treatment you can't be sure due to the systemic nature of the condition, it could always end up being a down stream consequence. So far at least neither scenario has happened, research is still moving forward quite slowly.
You are right. This is why I´m still looking in my DNA.
AND I found something odd:
Thalassemia
People with the sickle cell mutation in both copies of the HBB gene produce proteins that clump together and lead to changes in the shape and behavior of red blood cells.
I have 2 mutation: CAGCCTAAGGGTGGGAAAATAGACC : Inactivation of an acceptor RNA splice site by a short deletion in beta-thalassemia
Thalassemia is an inherited blood disorder that causes your body to have less hemoglobin than normal. Hemoglobin enables red blood cells to carry oxygen. Thalassemia can cause anemia, leaving you fatigued.
What Are the Signs & Symptoms of Beta Thalassemia? tiredness. shortness of breath. a fast heartbeat. pale skin. yellow skin and eyes (jaundice) moodiness. slow growth.