starryeyes
Senior Member
- Messages
- 1,561
- Location
- Bay Area, California
Interesting post Advocate. Thanks.
So far the names of infectious human retroviruses found in CFS are:
CAV - De Freitas et al. 1991
JHK - Grossberg et al. 2001
XMRV - Mikovits et al. 2009
Then there are numerous other studies from researchers at HEM and New Zealand, and Denmark where an infectious human retrovirus was found in CFS patients. And there was the Icelandic doctor who suspected an infectious human retrovirus in CFS in the 1950s. All of this is posted by me on p. 9 of this thread.
Thank you MissKoji who posted the link to the WPI FB page on p. 10 of this thread. They prove that CAV is not XMRV. Then that means we may have at least 2 infectious human retroviruses in us.
- so this brings us back to having 2 different infectious human retroviruses, and both may be murine retroviruses. And CAV was found in the mitochondria wreaking havoc from what I could ascertain and CFS has major mitochondrial dysfunction.Chronic Fatigue Immunodeficiency Syndrome-associated virus, hereafter referred to by the name CAV may be morphologically characterized as a retrovirus, particularly a non-C retrovirus which is capable of infecting humans.
...so this brings us back to having 2 different infectious human retroviruses, and both may be murine retroviruses. And CAV was found in the mitochondria wreaking havoc from what I could ascertain and CFS has major mitochondrial dysfunction.
So unless De Freitas et al made an error and didn't discover an infectious human retrovirus in PWC, we have 2 infectious human retroviruses in patients with Chronic Fatigue Syndrome.
Mine too.Your clock is perfect for CFS. Time is running away from us and we can never seem to catch up. That's exactly what my clock in the real world looks like to me.
If they are so sure they are different, why don't they put out a press release or at least post something on their website? Putting it as a note on Facebook just seems odd and it is not very well written. I just don't get it. Even if some of their findings are inconsistent with DeFreitas et. al.'s findings it seems to early to say with such conviction that they are different. Presumably technology was very different 20 years ago and maybe DeFreitas was wrong about certain assertions made about the virus size, etc. Maybe this is why it couldn't be replicated. I don't know but as others have said the best way would be either to go back to the samples used in 1991 and test them for XMRV or, if possible, test the XMRV patients for CAV.teejkay said:Do you dispute the points that the WPI made about XMRV being different from CAV? I don't know much about virology myself and I'd like to hear more of a discussion about it from those who do.
Between XMRV and CAV I don't think I can handle trying to figure out how a third virus relates to all this. But I know it is possible to have cross reactive antibodies--to think you have one virus when you actually have a different one. For example this page shows a list of things that can result in false positives for HIV antibodies.teejkay said:You bring up a good question. Also, if the JHK retrovirus is 96% similar to XMRV as JerryH pointed out, then are those 2 separate retroviruses and are we showing antibodies to one or the other or both?
Fact #9 XMRV was the only retro virus found in the WPI study
So, does that mean XMRV was the only virus they were looking for, or the only one they found?
If they are so sure they are different, why don't they put out a press release or at least post something on their website? Putting it as a note on Facebook just seems odd and it is not very well written. I just don't get it. Even if some of their findings are inconsistent with DeFreitas et. al.'s findings it seems to early to say with such conviction that they are different. Presumably technology was very different 20 years ago and maybe DeFreitas was wrong about certain assertions made about the virus size, etc.
>gb|AF326584.1| Human T-cell lymphotropic virus type 2 strain k96, complete proviral
genome
Length=8955
Score = 52.0 bits (26), Expect = 1e-09
Identities = 26/26 (100%), Gaps = 0/26 (0%)
Strand=Plus/Plus
Query 1 GTCTCCCCTAGCGCCCCCGCCGCCCC 26
||||||||||||||||||||||||||
Sbjct 1084 GTCTCCCCTAGCGCCCCCGCCGCCCC 1109
>gb|EU981609.1| Homo sapiens isolate day3_459_1 Xenotropic MuLV-related virus
integration site
Length=184
Score = 22.3 bits (11), Expect = 0.51
Identities = 11/11 (100%), Gaps = 0/11 (0%)
Strand=Plus/Plus
Query 5 CCCCTAGCGCC 15
|||||||||||
Sbjct 141 CCCCTAGCGCC 151