Given that literally tens of thousands of papers have been published using PCR in general and it has become the gold standard for confirming the presence of any new virus (this isn’t the 1980’s anymore when HIV was discovered), none of the scientists are worried about whether PCR itself works or not. No one is asking the question, “Is PCR a valid technique?” Instead, they are asking, is there really XMRV DNA in 100 to 250 ng of PBMC DNA in CFS patients? If there is XMRV DNA in 100 to 250 ng of PBMC DNA extracted from the blood of CFS patients, then standard DNA detection methods (ie PCR) can be used to detect it (unless tens of thousands of papers and the entire modern clinical diagnostic field are wrong about PCR being a valid technique).
PCR is a very valid technique for a yes or no question regarding specific conditions. It's like a polygraph. If I'm being investigated because the police suspect that I have too much money in my bank account and therefore it must be stolen, and let's say that the police thinks that anything beyond 2,000 dollars for me is more than I should have had if I didn't still anything, and let's assume that I actually have 499,999 dollars in my account - if the polygraph guy asks me "Is it true that you have 500,000 dollars in your bank account" and I say: "No", the lie detector would probably show that I lied. So the police will then think that I have something to hide - because they have knowledge of me having about 500 thousand of dollars, and yet I say "No", and the polgygraph is showing that I lied. But what can I do - even though the money that I really have in my bank account would confirm what they are thinking, I really don't have 500,000 dollars there.
If PCR was able to find out if we have said the truth or not, the way it can find out if certain DNA/RNA strains are in a sample - we would have a much better machine then a polygraph in order to find out whether someone is telling the truth or whether that someone is lying. However, if the situation was as was the situation that I mentioned above, PCR would also say that I'm lying. And it would also be correct. And yet, it would also divert the police from the truth, since they really really don't care if I have 499,999 dollars or 500,000 dollars.
And we really dont care if the strain is GTTCGGATTCGGTTTCCCAAAAAT or GTTCGGGATTCGGTTTCCCAAAAAT. But with some PCR conditions, you might find the first strain - which would be the strain that you cloned in order to calibarate your assay, but not find the second strain, which might be the strain that was in the blood of the patient. Should the patient care if another G enters there, somewhere? Probably not, and it would probably have no effect, or a very very minor effect on the possibilities of treatment. But a PCR test might tell him that he doesn't have "XMRV", while infact he have a strain of XMRV (which is a name of more than one genetic strain) that this PCR test cannot find.
In other words, to scientists in the field, a replication of what Lombardi et al did means simply running a validated PCR for any XMRV gene on blood samples from persons with CFS using at least 100 to 250 ng of PBMC DNA (which is found in 300 to 750 ng of DNA from whole blood). Using different PCR tests is not a failure to replicate, but is actually what is required to replicate in a way that shows the scientific community that what Lombardi et al found was not due to contamination or false positives.
False and misleading. First of all, replication of the Lomardi et al study means to do every single test that they did, on patients meeting the exact same criteria. That mean Canadian Consensus Criteria, and performing each of the following:
- nested PCR for gag and env.
- Intracellular flow cytometry
- Western Blot.
- Isolating B and T cells from a patient and testing it for antibodies.
- Co-culture activated lymphocytes with LNCaP.
- Incubate LNCaP cells with plasma samples and check for XMRV and test by PCR and IFC.
- Check by flow cytometry if the blood is reacting with a mouse B cell line expressing recombinent SFFV Env and not with samples without SFFV Env.
- See if the plasma is blocking the binding of the SFFV Env mAb to SFFV Env on the cell surface.
But doing all these would still not be a replication study. Let's see what the dictionary can tell us about "replication":
a copy; biologythe production of exact copies of complex molecules, such as DNA molecules, that occurs during growth of living organisms.
So what does that tell us, kids? Right! Every test that we do must be done
exactly as the WPI did it. Not "very much like", not "it's not the same but it should have worked". Exactly.
A replication study would mean to do the exact same things as were done in the first study, and do them all. Select the patients by the same criteria, take the same amount of blood that was taken from them in the first study, put it in the same kind of tubes, store it exactly the same, process it the same and check it the same. Some parts are almost impossible - they probably don't want to store those samples now for 2-3 years. But unless they did that, they cannot say that they have made a replication study. But while no one asks for the samples to be stored for 3 years before testing, we do ask for other things, that are very much possible to do: Choose patients by the same criteria; Process the samples exactly the same; Do all of the tests; And do the tests exactly as they were done by the WPI.
While every other month the authors of the Lombardi et al study seem to change their minds on the preferred method of detecting XMRV
Ugly. I believe that while Dr. Mikovits would be remembered as a great scientists in the history of the virology world, the persons who wrote this digusting letter would probably not be remembered at all, and if they would be remembered, they would be remembered as those that not only couldn't find XMRV even though it's very real, but also decided to throw mud at the scientist who discovered it's connection to ME/CFS and possibly other diseases too.
all they do is all built on the foundation of finding XMRV DNA in 100 to 250 ng of PBMC DNA. If the foundation of any structure is faulty, the entire structure collapses. Thus the other details mean nothing until the foundation has been proven solid.
The sentence about structures is correct, but the meaning behind this sentence is entierly misleading. I said it before, and I'll say it again: Let's say that you have a PCR test that would only find a virus if it has 99,236 nucletoides. You check a sample with a virus that have 99,238 nucleotides, and you don't find it. The difference of 2 nucletoides means nothing in reality, but the test would come back with a "negative" instead of a "positive". The WPI designed their tests in order to be able to find a virus that has many strains that are called together "XMRV". They tweaked their tests in order to find the best way to discover it. They also had luck. Let's say that they found the 99,236 nucleotides virus. Now, Cooperative Diagnostics is checking with a test that would find a virus if it has the exact 99,236 nucletoides in the same order. But what can we say, the virus has changed a little bit and instead of having a G somewhere after 40,000 nucleotides, it has a C there. Cooperative Diagnostics don't find it and say that there was not XMRV there. What are you telling me, that everytime that a nucleotide is changing in a virus we should call it by a different name? As the doctor who saved the lives of millions around the world said, it's not that HCV is one virus - it's a whole lot of similar viruses called by us humans by the same name.
It's not that their tests wouldn't recognize a virus if it had a single nucleotide change from 99,236 nucleotides. But it's also not that a retrovirus found in different time at different zones is expected to have a single nucleotide change and leave the other 99,235 nucleotides as they were.
PCR has it's limits, like all of the other assays - but some PCR assays have more limits regarding our certain case than others. Therefore, before you can even think to yourself that there is no XMRV here, you should perform the PCR test that was proven to be able to find XMRV in clinical samples before - because unlike when you calibarate your test with virus clones, in a clinical sample you don't know what the exact sequence is until you sequence the virus. And probably all of the 101 patients in the "Science" study had somewhat different sequences from one another, and a test that could find a certain sequence whenever it's there, might not be able to find a very very similar sequence, if it's too specific. In the study of Lo et al., and as we know also in the study of Dr. Hanson, they found somewhat different sequences, but that does not change anything important - because it can be expected, retroviruses mutate. Dr. Mikovits already showed in her lecture in January how one would not have found the Lo/Alter viruses using a certain PCR test, but would have found it using the test that the WPI developed after working very hard in order to do that.
But even if you work very hard in order to develope a PCR test that would found any MLV-like virus, your assay might still not be able to perform that. Since we don't know all the sequences out there, we cannot know that our assay detects them all. Or even most, or even 10% of them. Therefore, it's important to use other methods as well. And those methods should be able to find a very broad spectrum of MLV-like viruses as well. As I said, at least right now, it does not matter what you call it, as long as it's a MLV-like virus. 40% like the WPI's virus is not enough, but 85%, 90% is very very much enough.
Perhaps you will note that I mentioned the use of a “validated” PCR. It is important to define this word since it seems to cause a lot of confusion and means different things to different people. In the eyes of the FDA, there are no “validated” XMRV tests, because none has FDA approval. The type of validated test we are referring to is the acceptable “validation” process for use in research to be published in peer-reviewed literature. Specifically, the PCR must be able to detect a quantity of virus near the theoretical limit of a PCR reaction (ie 1 copy of viral DNA spiked into the sample type that will be tested). Since it is impossible to precisely add 1 virus at present, scientists settle for a close measurement of less than 10 to 20 copies. Such a test must also be checked to insure it does not have false positives. This has been done by every paper from Lombardi et al to all the negative studies.
Validated for what? GGCCTTAAACCCCCTGTTTGGG? Or GGCCTCAAACCCCCTGTTTGGG? So yes, you can validate that your assay would find GGCCTTAAACCCCCTGTTTGGG if it has about 10 copies there. But you can't validate that it would find any virus that is "only" 96% identical to your clone. and since 96% identical might very well be enough, that is of huge importance. So again, that is why you have to have a PCR that would discover a very braod spectrum of sequences, and to also test it by other ways.
For example: Dr. Singh found 6% of the prostate cancer patients that she tested to be positive for XMRV by a PCR test; But She also found another 21% to be positive for XMRV, or at least a gammaretrovirus, by immunohistochemistry. So what do Cooperative Diagnostics say, that all of these 21% that the PCR didn't find to be positive must be negative?
It is important to note that none of these are amateur scientists running experiments for the first time in their garage. Most have considerable experience in their field
So does Dr. Mikovits, with her 30 years experience in retrovirology. So does Dr. Hanson. So does the co-discoverer of HTLV-1, Dr. Francis Ruscetti. So does the co-discoverer of Hepatits C and Hepatitis C virus (and a contributer to the finding of HBV), the 75 years-old Dr. Harvey Alter.
and some may even be considered to be among the world’s most accomplished in the design of PCR diagnostics.
If you say that Drs. Ruscetti and Alter can be wrong, so does these doctors who are "among the wrold's most accomplished in the design of PCR diagnostics". It's only human. But it's more human with a method that might be too specific in order to find unknown strains of viruses.
So what the scientific community sees is that there is contradictory data with what are considered equally valid tests, 7 negative papers and one positive. There is no scientific consensus, at least not in support of XMRV association with CFS.
First of all, that's 2 positives, since the Lo/Alter paper clearly confirmed the WPI's findings, even if the sequences were only similar and not identical, and good virologists should know that it's likely that a retrovirus would mutate. Second of all - what kind of scientist begins to measure how much papers are in favour and how much oppose? It's like I've said many times: If I have VP62 on the floor, and I decide that if I will put some cola on that the floor would turn green - and I do that a hundred times and the floor stays white - that doesn't mean I don't have VP62 there. It means that my test couldn't find it. And if I have a virus that is 95% identical to VP62, but my test can only find a virus that is 95.1% identical to VP62, even if the test is perfect at finding these >=95.1% identical-to-VP62 strains, it would still say "negative", but the interpertation is not that there is no MLV-like virus there, the interpertation is that there is not 95.1%-identical-to-VP62 strain there.
It is not uncommon for a single peer-reviewed article to disagree with the original finding, but to have 100% of them disagree is historically a very bad sign
It's not 100% since the Lo/Alter paper is in agreement with the "Science" paper, which by itself checked his samples in 3 seperate laboratories, and the studies of Dr. Hanson and Dr. De-Merleir are also in agreement with the "Science" paper, and also the findings of VIP Dx and RED Laboratories are in agreement with the "Science" paper.
Add to that the other replication studies finding that what they originally thought were positives were actually contamination
These were not replication study and the fact that McClure and Huber did not take approapriate measures to avoid contamination says very little, if anything. The WPI clearly took great measures to show that it's not a contamination, as was also done in the Lo/Alter study.
the finding that what appeared to be XMRV integrated into human genomes in clinical samples was also a contaminant
No one found that it was a contaminant, if anything they just showed that it's, in their very biased opinion, likely, and I really tend to believe that many, more known and experienced researchers, would disagree with them.
and the fact that the Lombardi et al authors had a false positive in the only negative control in the preliminary blood working group study and you see the picture that most scientists are seeing now.
This was found to be a human DNA strain by the WPI itself, by sequencing, a process that they have done with any of the hundreds of positives that they found during the last 2 years. And if Dr. Simmons said he is not concerned with that, than why should I listen to Cooperative Diagnostics?
What picture do most scientists see now? I doubt if it's the picture that Dr. Mikovits, Dr. Francis Ruscetti, Dr. Sandra Ruscetti, Dr. Lo, Dr. Hanson, Dr. De-Merleir, Dr. Singh, the scinetists at VIP Dx, the scientists at RED Laboratories, the scinetists from the spainish hospital and many others see. I doubt if that's the picture that the discoverer of Hepatits C and Hepatits C Virus and the person that was awarded the Distinguished Service Medal, the highest award conferred to civilians in United States government public health service, the 2000 Albert Lasker Award for Clinical Medical Research and the American College of Physicians Award for Outstanding Work in Science as Related to Medicine (and that's not all of it), Dr. Harvey Alter, sees:
But I still want to counter by saying I think the current evidence for disease association is very strong, even though not universally confirmed. But it has been confirmed now in at least four studies, two of which were presented today, that either XMRV or a polytropic MLV is associated strongly with chronic fatigue syndrome. A point that I think was misrepresented today: In those labs who do find the agent, it is very reproducible. Judy has found the same patients to be positive by culture year after year. We have found a patient to come back after 15 years and still be positive. So this is not a single, isolated finding. It's confirmed by sequencing. It's reproducible over time.
Dr. Hanson has shown today how critical the assays are. When she tweaked her assay, she went from no findings to findings almost identical to the Lo lab. The diversity is now being confirmed also in the original WPI group. XMRV isn't the only agent even in the WPI lab.
Despite the very legitimate concern for contamination -- I think this is a serious issue -- there have been hundreds of negative controls in the same laboratory that are always consistently negative. An extremely sensitive mouse mitochondrial DNA has always been negative in the Lo laboratory. Lo has done the IPA assay that Dr. Coffin recommended. That is also negative. There just has been no evidence for contamination. Although you could say maybe the negatives could be negative somehow and the positives positive for contamination reasons, it really is not logical that that would be so.
