Another negative XMRV CFS study - is this new? looks to be from CDC

[kurt]

Satterfield et al 2011 (the paper under discussion, available here http://www.retrovirology.com/content/8/1/12) referenced Danielson et al 2010 at no [17] in their paper. They said they knew, from Danielson, that 600ng of prostate DNA was necessary to be able to find XMRV with their PCR assay.

But what did they do? they used 0.25 ug of DNA (from plasma). Aha! Now can you see there's a problem? They also used the VP62 clone to calibrate, 10 times less sensitive than using live virus.

Satterfield also, just to make sure this would be another negative paper to outweigh the real stuff, used the cycling conditions and primers from Switzer et al 2010.

The serology assay that was used in the macaque monkey study found XMRV in the blood of their subjects two weeks after infection. They then found, one month later, that they could no longer detect the XMRV using the VP62 assay. But, as we know, on sacrificing the poor animals (I have problems with this arm of science :worried: *crying*) they found that XMRV had hidden itself away in internal organs. I would suggest that the subjects of Satterfield's study were rather further than two weeks from infection, but I'm glad that no more primates were sacrificed in order to autopsy.

jace,
What test are you talking about? On p.5 they describe using 2.5ug of DNA (not .25), which is 833ng of PBMC DNA, in one of the tests. This was several times the amount of DNA used in the WPI Science study. Beyond that, this test was 10x more sensitive, based on calibration measures they can detect 1 copy of XMRV or MuLV in 2,500 ng of DNA. I don't think they are making simple errors of arithmetic like you seem to suggest. And most definitely they are not intentionally subverting their research just to persecute CFS patients. Something else is going on here, eventually it will be found out.

 

[jace]

Hi Kurt,

If you look at table 2 in the provisional pdf, linked above, you will see the gag cycling conditions:

0.25 μg
DNA;
RNA
from 62
μL
plasma

I doubt too that they were deliberately subverting their research, but the question stands, why not replicate Lombardi, in every detail? And another question arises, why the misleading statement on page 5?

 

[kurt]

Hi Kurt,

If you look at table 2 in the provisional pdf, linked above, you will see the gag cycling conditions:

I doubt too that they were deliberately subverting their research, but the question stands, why not replicate Lombardi, in every detail? And another question arises, why the misleading statement on page 5?

OK, you are right, they ran multiple PCR tests (2,500 ng, 1,000 ng, and 250 ng), which means one test was indeed with .25 ug DNA. Sorry, I missed that table in my quick read. But I believe that was actually the identical amount of DNA used by Lombardi et al in the PCR test reported in the Science article.

So they were attempting to replicate the Lombardi study in many details. The Science article set up parameters within which XMRV should be detectable. They were well within those parameters for PCR testing. This might not be clear because Cooperative & CDC also used their own test designs to enhance the resolution of their testing.

Since I think you asked good questions others might have as well, I have passed your questions along to Cooperative and got some answers back. I have asked for permission to post what they said (stay tuned). I'll post more if/when I get permission.

Which statement do you refer to on p.5? I think that was just my missing where the .25 ug test was reported, so that was probably me, not them.

 

[kurt]

jace and all, here are the responses I received (posted with permission from private correspondence):

[regarding the .25ug test]
Satterfield et al used 3 DNA tests, 2 RNA tests and an antibody test. Of the 3 DNA tests, one used 2,500 ng, another used 1,000 ng, and the final, which was actually the test used by Lombardi et al, used 250 ng. So why were only 250 ng (0.25 ug) used? Because that was how much Lombardi et al used.

Satterfield et al used two different controls to validate the detection limit of their PCR tests, including VP62 plasmid and 22Rv1 cells. Since VP62 is a plasmid, the exact copy number can be determined, allowing for precise measurement of detection limits. This is actually the proper way to determine the detection limit of a test. In a PCR test, it is impossible to have a detection limit better than 1 viral copy/reaction. All the PCR tests were shown to have this detection limit. Since each test used a larger amount of DNA than Lombardi et al and could detect 1 copy in that amount of DNA, the tests were actually more sensitive than what Lombardi et al did. As to 22Rv1 cells, they are the only cell line with undisputed positivity for XMRV. This cell line is the closest thing there is to an actual “clinical” sample, since the positives found by others are under debate as being a mix of false positives and contamination.

[regarding use of the Switzer assays]
Out of the 3 DNA tests, the 2 RNA tests and the antibody test, only one used the same cycling conditions and primers from Switzer et al. 2010.

[regarding use of the monkey study test]
It is true that the virus was only detectable in the blood by PCR for a short time [in the monkey study]. This actually argues against the Lombardi et al paper that found XMRV DNA in 67% of [presumably banked] CFS blood samples by PCR. [their samples were from established CFS cases, far beyond two weeks post-infection]

In retroviral detection in general, the antibodies are present throughout the lifetime of the infection. Since all known human retroviruses are incurable, that means antibodies are present for life. They are present whether or not blood viral levels fall to levels undetectable by PCR.

We used an antibody test using actual XMRV proteins as antigen, and the only antibody test validated on known positive subjects (the monkeys, who were surely infected with XMRV, since roughly a million XMRV viruses were pumped into their blood) was used to see if low level XMRV infections were present that would not have been detected by PCR.

 

[jace]

May I ask who wrote that, please, Kurt?

 

[jace]

The concentration of virus DNA/RNA would need to be an order of magnitude higher, because Lombardi used DNA from PMBCs contained in 8 ml of blood, or 5 times 10 to the power of 6 PMB cells. Sattersfield isolated DNA from 0.62 ul of plasma. it does not take a rocket scientist to realise that the concentration of viral DNA in 0.25ul used by Gombardi was many orders of magnitude greater than the amount of DNA/RNA in Sattersfields assay.

It is unlikely that the amount of plasma used contained even one virion.

Their technique of calibrating cycling conditions to detect XMRV DNA/RNA in vitro simply dont work in vivo. This has now been proven by Danielson.

The assay used by Sattersfield was based on the one by Danielson and others. Switzer and Sattesfield read the study. The Danielson study said that the assay could not detect XMRV GAG or POL sequences in people known to be infected, but Switzer and Sattersfield used it any way clearly having an intention of using ineffective assays.

It is the concentration of viral sequences which is crucial. It is very simple chemistry. Initial concentration of product determines the concentration of reactant. Add in primer combinations and cycling conditions which have never detected XMRV GAG sequences in an infected person and failure is absolutely guaranteed.

 

[free at last]

Can i ask you Jace in a nutshell so even my limeted understanding can get to grips with what your saying. Do you belive no PCR study has to date been comparable to the wpis in terms of being able to detect the virus ? and what of the monkey study showing low rates of detection versus wpis high rate of detection anomaly is there a answer for that do you know, because on the one hand it makes sense for the negative studys, but makes little sense compared to the science study

 

[alex3619]

Plasma?!!!!

The concentration of virus DNA/RNA would need to be an order of magnitude higher, because Lombardi used DNA from PMBCs contained in 8 ml of blood, or 5 times 10 to the power of 6 PMB cells. Sattersfield isolated DNA from 0.62 ul of plasma. it does not take a rocket scientist to realise that the concentration of viral DNA in 0.25ul used by Gombardi was many orders of magnitude greater than the amount of DNA/RNA in Sattersfields assay.

It is unlikely that the amount of plasma used contained even one virion.

Hi jace, I am glad you posted this. I have not checked your math, so cannot comment on it (bad math day) but one thing struck me this time. Something big stood out, I should have seen it in the original paper (I really hate brain fog).

The CDC paper says:

A subset of 48 plasma samples were tested for viral RNA sequences by RT-PCR using
primers from the nested gag assay and also by using a new quantitative RT-PCR test that generically detects MuLV and XMRV gag sequences.

You pointed out the plasma link. Why in heck are they testing plasma? Is not remotely equivalent to blood for this virus. After the first month, except for viral reactivation, XMRV is not in plasma. We know this from the animal studies. We also know that viral inactivation is rampant in the blood. The only reliable source is infected cells, particularly integrated DNA. Plasma excludes that, unless I am missing something. This specific test was designed in such a way that it should fail. No more plasma studies!

I have said this before, and I am sure I will again, we need biopsy studies, not blood. Blood studies are about blood banks and not patients.

Bye
Alex

 

[kurt]

The concentration of virus DNA/RNA would need to be an order of magnitude higher, because Lombardi used DNA from PMBCs contained in 8 ml of blood, or 5 times 10 to the power of 6 PMB cells. Sattersfield isolated DNA from 0.62 ul of plasma. it does not take a rocket scientist to realise that the concentration of viral DNA in 0.25ul used by Gombardi was many orders of magnitude greater than the amount of DNA/RNA in Sattersfields assay.

Are you mixing several tests together in this statement? From the Satterfield et al study, p.5:

"2.5 μg of DNA (833 ng of PBMC DNA) was used in the pol real-time PCR test, providing for 3.3 to 8.3 times the PBMC DNA used by Lombardi et al. [5,14]."

 

[kurt]

The concentration of virus DNA/RNA would need to be an order of magnitude higher, because Lombardi used DNA from PMBCs contained in 8 ml of blood, or 5 times 10 to the power of 6 PMB cells. Sattersfield isolated DNA from 0.62 ul of plasma. it does not take a rocket scientist to realise that the concentration of viral DNA in 0.25ul used by Gombardi was many orders of magnitude greater than the amount of DNA/RNA in Sattersfields assay.

It is unlikely that the amount of plasma used contained even one virion.

Their technique of calibrating cycling conditions to detect XMRV DNA/RNA in vitro simply dont work in vivo. This has now been proven by Danielson.

The assay used by Sattersfield was based on the one by Danielson and others. Switzer and Sattesfield read the study. The Danielson study said that the assay could not detect XMRV GAG or POL sequences in people known to be infected, but Switzer and Sattersfield used it any way clearly having an intention of using ineffective assays.

None of the above is correct, per Dr Satterfield. They did not use 0.62 ul of plasma in the plasma test, but 62 ul. And they ran tests on both plasma and extracted DNA, plasma testing is to find out if there is active virus. WPI did not report any plasma test in the Science article, but I suspect they ran some. I have answers to the rest of these comments as well, but it's late here, if you want more info I can post more later.

 

[jace]

Hi Alex, the plasma is for serology, looking for antibodies to XMRV.

Hi Free at Last, the short answer is no, no-one has yet replicated the WPI/CC/NCI science study. NO ONE. Yet that was the basic next step to take after the publication in Oct 09. Everyone thinks they know better, and don't need to take so much care.

Hi Kurt, as I showed above, table 2 from the Satterfield study pdf showed DNA and RNA from 62 ul (third and fourth sections). The other tests do not state quantities used. If I said .62, I apologize. That was a typo that I missed.

As an example of the attitude of the scientists who failed to find XMRV, here is a transcript of the Vincent Raciniello TWIV 99 interview with Myra McClure

(Vincent) In fact no study has had a known positive human control

(Myra) Except the original?

(Vincent) Except the original one. And that would probably help everyone if that were part of the study

(Myra) Of course it would.

Do you have any plans to go back and use primers... ?

Well we don't have to, because when we set up our PCR we did it with two primer sets, one of which was specific for XMRV, and that encompassed the 24 bit piece deletion that you were talking about, that is specific for XMRV, and another set which we reckoned would pick up, or amplify all known MLV's with a very highly conserved region within the pol gene reverse transcriptase so had that polytropic virus been there we should have picked that up, and the CDC likewise, they used MLV generic primers and they didn't pick it up either. So you know, there's no point in me going back, I'd just get the same result.

You have no plans to revisit those samples at the moment?

No, I have no plans to revisit those samples because I'm quite confident of the result and the result we would get. What I have plans for doing, I emailed my collaborator this week after the XMRV meeting, is to say look we've never looked at fresh samples and the argument which Judy Mikovits would put forward was, you've all looked by PCR and serology, but you haven't tried to grow the virus in culture. Now most retrovirologists would say alright we'll do a quick PCR first on our tissue and if it's positive we'll go back and get fresh tissue and grow out and that's what we're doing with our prostate cancers.

We get fresh biopsies, we do a quick PCR to see if it's positive for XMRV, and if it is then we'll go back and try to isolate virus. But, ah, we haven't had any positives.

In this Satterfield study, the authors report that they are using the most sensitive PCR approach yet reported in any study involving XMRV. They refer to Danielson et al 2010 (1) which is referenced [17] in the study. The authors state that they are aware that Danielson et al reported that 600ng of prostate DNA was needed to produce a positive result with their PCR assay.

The authors fail to mention that Danielson and others successfully detected XMRV using primers and cycling conditions which could detect env sequences. When they attempted to detect gag and pol sequences they were unable to do so using the same PCR assay. The difference was that in the latter case they used the technique of using a dna sample spiked with VP-62 to calibrate their PCR approach. The authors also detected that the technique of calibrating their assay with VP62 GAG was 10 times less sensitive than calibrating their PCR assay with integrated env sequences.

Sattersfield et al have clearly read this paper yet choose not to use the approach that successfully detected XMRV but instead have chosen to use the approach that could not.

Having read the paper by Danielson et al which clearly stated that the amount of input DNA was crucial, PCR gag assays at Co-op Diagnostics used 0.25 ug of DNA or cDNA isolated from 62ul of plasma. The chance of any virions being present in such a miniscule volume of plasma were slim indeed. Thus far no PCR assay developed by Co-op Diagnostics has ever shown any ability to detect XMRV. Thus it seems strange that the CDC would choose to collaborate with a private company whose methodology has no provenance of success.

The PCR work carried out by the CDC used the cycling conditions and primers used by Switzer et al 2010 (2) which were unable to detect XMRV in clinically positive samples during the participation of the CDC in the blood working group. There were subtle variations in the approach used in this study. Given that the authors assert that subtle variations do not determine the difference between success and failure the choice of this PCR assay once more is difficult to explain.

Thus the patients recruited from primary care via an on line survey were only examined at Co-op Diagnostics using a PCR approach found to be ineffective by Danielson et al. There is in fact no objective evidence that the patients recruited had PEM nor is the concept of PEM defined in this study.

The expectation that a serology assay would work because it was able to detect XMRV antibodies in the blood of infected macaque monkeys (3) two weeks after inoculation would also seem unreasonable on two counts. Firstly it is unlikely that the patients would have been infected in the last two weeks and secondly the antibody titres were found to dramatically drop thereafter. The authors also seem to forget that after a short period of time PCR was not able to detect XMRV in the blood of these animals even though the virus was detected in lymphoid tissue.

When considered as a whole the results can easily be explained by the use of techniques with a provenance of failure instead of using techniques with a provenance of success. Susan Vernon of the CAA described the original study conducted by Switzer et al as a study designed not to detect XMRV. An objective analysis seems to suggest that this study is of identical design. The use of an assay known for its inability to detect XMRV in the blood of infected people and an assay by Co-op diagnostics withdrawn because of its inability to detect XMRV would support the kind of argument that Susan Vernon made about the study by Switzer et al.

1) BP Danielson, GE Ayala and JT Kimata; Detection of Xenotropic Murine Leukemia Virus-Related Virus in Normal and Tumor Tissue of Patients from the Southern United States with Prostate Cancer Is Dependent on Specific Polymerase Chain Reaction Conditions; J Infect Dis. (2010) 202 (10): 1470-1477. doi: 10.1086/656146

2) Switzer WM, et al. (2010) Absence of evidence of xenotropic murine leukemia virus-related virus infection in persons with chronic fatigue syndrome and healthy controls in the United States. Retrovirology 7:57.

3) N Onlamoon, J Das Gupta, P Sharma, K Rogers, S Suppiah, J Rhea, RJ Molinaro, C Gaughan, B Dong, E A Klein, X Qiu, S Devare, G Schochetman, J Hackett Jr, RH Silverman, and F Villinger; Infection, viral dissemination and antibody responses of Rhesus macaques exposed to the human gammaretrovirus XMRV; J. Virol. doi:10.1128/JVI.02411-10

 

[kurt]

Hi Alex, the plasma is for serology, looking for antibodies to XMRV.

Hi Free at Last, the short answer is no, no-one has yet replicated the WPI/CC/NCI science study. NO ONE. Yet that was the basic next step to take after the publication in Oct 09. Everyone thinks they know better, and don't need to take so much care.

Hi Kurt, as I showed above, table 2 from the Satterfield study pdf showed DNA and RNA from 62 ul (third and fourth sections). The other tests do not state quantities used. If I said .62, I apologize. That was a typo that I missed.

. . . . (see jace's post above)

Jace,
This is an argument that appears to follow the basic XMRV conspiracy theory. I don't have the knowledge to dispute all those issues point by point and so asked Cooperative to respond. Below is an email response I received from Cooperative.
--Kurt

Kurt,

There seem to be a few general misunderstandings about what a replication study is in validation of the finding of a new virus. Rather than responding to the numerous errors from incorrect citation of articles and from lack of understanding of the fundamental science by whoever wrote the post quoted by Jace, I think it might be more useful to give an overview of what scientists in the field are actually doing. This should also help you understand what consensus the scientific community is arriving at and why. If you or Jace still have questions after reading through this, please feel free to let us know. While we do not have time to answer every question, we will do our best.

The principal finding in the Lombardi et al study (ie detecting 67% of CFS blood samples as positive) was found by PCR amplification of the XMRV gag gene using 100 to 250 ng of PBMC DNA. Given that literally tens of thousands of papers have been published using PCR in general and it has become the gold standard for confirming the presence of any new virus (this isn’t the 1980’s anymore when HIV was discovered), none of the scientists are worried about whether PCR itself works or not.

No one is asking the question, “Is PCR a valid technique?” Instead, they are asking, is there really XMRV DNA in 100 to 250 ng of PBMC DNA in CFS patients? If there is XMRV DNA in 100 to 250 ng of PBMC DNA extracted from the blood of CFS patients, then standard DNA detection methods (ie PCR) can be used to detect it (unless tens of thousands of papers and the entire modern clinical diagnostic field are wrong about PCR being a valid technique).

In other words, to scientists in the field, a replication of what Lombardi et al did means simply running a validated PCR for any XMRV gene on blood samples from persons with CFS using at least 100 to 250 ng of PBMC DNA (which is found in 300 to 750 ng of DNA from whole blood). Using different PCR tests is not a failure to replicate, but is actually what is required to replicate in a way that shows the scientific community that what Lombardi et al found was not due to contamination or false positives.

This means that from the point of view of the majority of scientists, 7 peer-reviewed publications have now replicated the key elements of the Lombardi et al study and found no evidence that XMRV is PCR detectable in 100 to 250 ng of PBMC DNA from persons with CFS. While every other month the authors of the Lombardi et al study seem to change their minds on the preferred method of detecting XMRV, all they do is all built on the foundation of finding XMRV DNA in 100 to 250 ng of PBMC DNA. If the foundation of any structure is faulty, the entire structure collapses. Thus the other details mean nothing until the foundation has been proven solid.

Perhaps you will note that I mentioned the use of a “validated” PCR. It is important to define this word since it seems to cause a lot of confusion and means different things to different people. In the eyes of the FDA, there are no “validated” XMRV tests, because none has FDA approval. The type of validated test we are referring to is the acceptable “validation” process for use in research to be published in peer-reviewed literature. Specifically, the PCR must be able to detect a quantity of virus near the theoretical limit of a PCR reaction (ie 1 copy of viral DNA spiked into the sample type that will be tested).

Since it is impossible to precisely add 1 virus at present, scientists settle for a close measurement of less than 10 to 20 copies. Such a test must also be checked to insure it does not have false positives. This has been done by every paper from Lombardi et al to all the negative studies. It is important to note that none of these are amateur scientists running experiments for the first time in their garage. Most have considerable experience in their field, and some may even be considered to be among the world’s most accomplished in the design of PCR diagnostics. Each has performed the standard process for validating their tests and shown the data in their papers.

In other words, in the eyes of the scientific community, each of the tests in the negative studies is just as valid as the tests used by Lombardi et al. So what the scientific community sees is that there is contradictory data with what are considered equally valid tests, 7 negative papers and one positive. There is no scientific consensus, at least not in support of XMRV association with CFS.

As an example of the kind of consensus that can and should arise in the scientific field when a finding is actually correct, consider Dusty Miller’s work on XMRV in 22Rv1 cells. Dr Miller’s lab is the only lab to have found XMRV in a human cell line, published it and then had 100% consensus among peer-reviewed papers. Not a single scientist, regardless of their position on XMRV in CFS and prostate cancer, has disputed Dr. Miller’s finding.

Note that in replicating or confirming Dr. Miller’s finding on XMRV, most papers, including ours, used their own PCR test. With such consensus from opposing sides, each with a different PCR test, it is easy to state that Dr. Miller’s finding has been not only replicated but also “validated.” This consensus from both sides, ironically using many of the same tests that agree on the presence of XMRV in 22Rv1 cells, is clearly not present with respect to the presence of XMRV in CFS.

Contrast the 100% consensus for Dr. Miller’s work with the 1 positive and 7 negative articles on XMRV in CFS. It is not uncommon for a single peer-reviewed article to disagree with the original finding, but to have 100% of them disagree is historically a very bad sign. Add to that the other replication studies finding that what they originally thought were positives were actually contamination, the finding that what appeared to be XMRV integrated into human genomes in clinical samples was also a contaminant and the fact that the Lombardi et al authors had a false positive in the only negative control in the preliminary blood working group study and you see the picture that most scientists are seeing now.

This doesn’t mean the door is closed on XMRV, but certainly means that the odds are low for it panning out. It also does not mean that other retroviruses or infections are not involved in the pathogenesis of CFS. There are still quite a few hypotheses on infectious triggers to CFS that should be pursued. As more hypotheses are generated and tested for CFS, the probability that one will pay dividends improves. While XMRV may not pan out, no one can dispute that this possibility has escalated the seriousness with which society takes CFS (take banned blood donations as an example) and has brought much needed attention to a disease poorly understood by society. Maybe this attention can be used in a positive way to finally bring about the changes that are needed.

 

[alex3619]

Hi jace and kurt, the plasma was tested for both XMRV RNA and antibodies. Both could be expected to fail in most instances from what we know from the animal studies. The PBMC DNA nested PCR is my main concern. Biopsies would avoid all this debate - its where the virus hides in largest numbers, so highly sensitive testing would be far less important.

I am more interested in the quote kurt cites : the finding that what appeared to be XMRV integrated into human genomes in clinical samples was also a contaminant

Does anyone know anything about this? Most of the contamination "conclusions" I have seen are tentative at best.

Bye
Alex

 

[jace]

Alex, you are dead right when you say

I am more interested in the quote kurt cites : the finding that what appeared to be XMRV integrated into human genomes in clinical samples was also a contaminant

Does anyone know anything about this? Most of the contamination "conclusions" I have seen are tentative at best.

We know full well that the only thing those four papers published on the same day in the same paper (retrovirology) proved that you have to be careful to exclude the possibility of contamination. Tower's press release, on the other hand, rather stretched those findings, for political reasons IMHO. No one has proved contamination to be a problem in any of the positive studies.

Hi Kurt, Thank your friends at CoOp Dx for me, won't you? I couldn't actually read their post, without cutting, pasting and adding para breaks. You might like to learn that this is a common problem for people with ME/CFS. I have not quoted it all here, just most of it.

There seem to be a few general misunderstandings about what a replication study is in validation of the finding of a new virus. Rather than responding to the numerous errors from incorrect citation of articles and from lack of understanding of the fundamental science by whoever wrote the post quoted by Jace, I think it might be more useful to give an overview of what scientists in the field are actually doing.

Sweet. I love you too. If you can't attack the ideas, attact the person, huh?

This should also help you understand what consensus the scientific community is arriving at and why. If you or Jace still have questions after reading through this, please feel free to let us know. While we do not have time to answer every question, we will do our best.

The principal finding in the Lombardi et al study (ie detecting 67% of CFS blood samples as positive) was found by PCR amplification of the XMRV gag gene using 100 to 250 ng of PBMC DNA.

No, XMRV was not isolated originally by PCR but by a microarray technique. What Urisman did was to develop a PCR assay which was able to detect XMRV provirus in a person which was known to be infected. This required particular cycling conditions and a reverse transcriptase nested PCR to obtain the quality of cDNA needed. This also took particular cycling conditions and the appropriate concentration of magnesium ions which acts as a co catalyst in the reaction.This also required the use of primers with a particular melting point. PCR, like every chemical reaction, is governed by the laws of thermodynamics.
Lombardi replicated this method exactly but dropped the annealing times to make allowances for the lower concentration of DNA espected which provided the thermodynamic impetus to power the reaction.

Given that literally tens of thousands of papers have been published using PCR in general and it has become the gold standard for confirming the presence of any new virus (this isnt the 1980s anymore when HIV was discovered), none of the scientists are worried about whether PCR itself works or not.

I refer you to the Myra McClure quote below.

No one is asking the question, Is PCR a valid technique? Instead, they are asking, is there really XMRV DNA in 100 to 250 ng of PBMC DNA in CFS patients? If there is XMRV DNA in 100 to 250 ng of PBMC DNA extracted from the blood of CFS patients, then standard DNA detection methods (ie PCR) can be used to detect it (unless tens of thousands of papers and the entire modern clinical diagnostic field are wrong about PCR being a valid technique).

There are many variables in PCR, and they know it. Annealing temperatures, primer sequences...
In other words, to scientists in the field, a replication of what Lombardi et al did means simply running a validated PCR for any XMRV gene on blood samples from persons with CFS using at least 100 to 250 ng of PBMC DNA (which is found in 300 to 750 ng of DNA from whole blood). [/QUOTE]
And they are supermen (don't tell anyone, but they've never been able to find XMRV) (Even though they were offering a paying test a while ago which didn't work either) (Sshhh don't tell anyone)

Instead, they are asking, is there really XMRV DNA in 100 to 250 ng of PBMC DNA in CFS patients? If there is XMRV DNA in 100 to 250 ng of PBMC DNA extracted from the blood of CFS patients, then standard DNA detection methods (ie PCR) can be used to detect it (unless tens of thousands of papers and the entire modern clinical diagnostic field are wrong about PCR being a valid technique).

The titres of HIV are many orders of magnitude higher than those for a gammavirus and hence PCR is working at the limits of its sensitivity. MLV viruses are notoriously difficult to isolate in blood using PCR. The question is whether PCR on blood cell samples is a valid technique for the detection of a virus when those cells are not the primary reservoir of the virus. Even a modicum of research will reveal that. Valid does not mean diagnostically sensitive enough or appropriate for the task in hand. Using DNA isolated from a mere 0.62muL of plasma is just foolish given the wealth of information of published data on MLV viruses. Perhaps the term "AIDS wars" will ring a bell? HIV was not discovered using PCR, it was discovered using culturing. The same people who disputed the existence of HIV, and then that HIV caused AIDS, are now disputing the existence of HGRVs. It took 10 years to produce a clone of HIV. Satterfield does not understand PCR and now rewrites history! Thousands of papers are published on HIV, and in the early days of PCR and HIV failures were commonplace.

In other words, to scientists in the field, a replication of what Lombardi et al did means simply running a validated PCR for any XMRV gene on blood samples from persons with CFS using at least 100 to 250 ng of PBMC DNA (which is found in 300 to 750 ng of DNA from whole blood). Using different PCR tests is not a failure to replicate

This just demonstrates a lack of knowledge of the principles involved in a PCR chemical reaction. The PCR cycling conditions are crucial as are the other constituents such as primer concentration, DNA concentration, magnesium ion concentration and so forth. The only way of adjusting PCR conditions to detect a provirus in vivo is either to replicate a PCR assay exactly or to adjust different cycling conditions using a clinically positive sample. In other words follow the scientific method.

..../ Each has performed the standard process for validating their tests and shown the data in their papers. In other words, in the eyes of the scientific community, each of the tests in the negative studies is just as valid as the tests used by Lombardi et al.

Read the comments posted against many of the negative studies. The methods were often roundly criticised in the paper of original publication

So what the scientific community sees is that there is contradictory data with what are considered equally valid tests, 7 negative papers and one positive. There is no scientific consensus, at least not in support of XMRV association with CFS.

Umm. I thought that at the Blood Working Group, apart from Lombardi, Cheney, Streyer, Hanson, and Lo all have a positive CFS HGRV studies published, as shown in BWG PDF I attach here. If this is the quality of their information, then I despair.

As an example of the kind of consensus that can and should arise in the scientific field when a finding is actually correct, consider Dusty Millers work on XMRV in 22Rv1 cells. Dr Millers lab is the only lab to have found XMRV in a human cell line, published it and then had 100% consensus among peer-reviewed papers.

This consensus from both sides, ironically using many of the same tests that agree on the presence of XMRV in 22Rv1 cells, is clearly not present with respect to the presence of XMRV in CFS. Contrast the 100% consensus for Dr. Millers work with the 1 positive and 7 negative articles on XMRV in CFS. It is not uncommon for a single peer-reviewed article to disagree with the original finding, but to have 100% of them disagree is historically a very bad sign.

This is just not true. See .pdf attached

Add to that the other replication (???) studies finding that what they originally thought were positives were actually contamination, the finding that what appeared to be XMRV integrated into human genomes in clinical samples was also a contaminant and the fact that the Lombardi et al authors had a false positive in the only negative control in the preliminary blood working group study and you see the picture that most scientists are seeing now.

Sattersfield claims that he is not an amateur carrying out PCR in a garage. Why then does he behave as though he is? Sattersfield has not been able to design a PCR assay capable of detecting a HGRV in the blood of an infected person and neither has Switzer. This is their level of expertise which Sattersfield believes qualifies for the title of an expert in PCR design, moreover Sattersfield used an RT assay for gag which was proven to be ineffective in an earlier study. Someone should tell them that the approach needed to detect a new class of retroviruses is to replicate a successful method of detection and not the unsuccesful ones.

From Kurt in his post above:

This is an argument that appears to follow the basic XMRV conspiracy theory. I don't have the knowledge to dispute all those issues point by point and so asked Cooperative to respond. Below is an email response I received from Cooperative.
--Kurt

This is why I posted the quote from Myra McClure in my earlier post. Here it is again.

Now most retrovirologists would say alright we'll do a quick PCR first on our tissue and if it's positive we'll go back and get fresh tissue and grow out and that's what we're doing with our prostate cancers.

We get fresh biopsies, we do a quick PCR to see if it's positive for XMRV, and if it is then we'll go back and try to isolate virus. But, ah, we haven't had any positives.

Incompetence, arrogance, or conspiracy? It's anyone's call. Time will tell. Meanwhile, the WPI soldier on, funded by patient's pennies, with at least ten bids for public funding refused since the Science study, and with several important papers unable to find a decent publisher. Expensive rubbish like the UK PACE study conflate diseases and spin statistics, moving goal posts as they go, Retrovirology publish poor quality negative paper after paper, and the monolith of lies created about us by the CDC aided and abetted by the CAA, if questioned, prove us to be crazy angry fools.

If XMRV/HGRV's pan out as the puppet master in ME/CFS, then a lot of folk will have egg on their face, and pain in their bank balances. On the other hand, there is the potential for a massive shift towards a cure for many neuro-immune diseases and cancers. This is so important to the health of the human race, it must be beyond ego and personal gain or loss.

The information on how to find XMRV is available in published papers (Mikovits et al, Danielson et al) and yet no-one follows the recipe accurately. HRGV's are hard to find. I have a sneaking suspicion that once the facts are gathered in, they will be easier and cheaper to push into latency than we currently believe.

 

[jace]

After writing the above, I came across the article below, which seems pretty relevent to this discussion.
Walking on eggshells: PCR assays for XMRV detection
02/23/2011 Andrew S. Wiecek
Are positive XMRV studies the result of contamination? Or is PCR just not sensitive enough to detect XMRV? Andrew Wiecek investigates the controversy surrounding PCR detection of XMRV.
http://www.biotechniques.com/news/W...-for-XMRV-detection/biotechniques-311717.html

According to the WPI group, nested PCR of cultured samples provided the best results for XMRV detection. Capable of amplifying single molecules within a large sample, it is used when targeted DNA templates are in extremely low concentrations. So-called for the way it “nests” two runs using two sets of primers, the product of the first PCR run becomes a template for the second. The technique’s only limitation is the amount of template DNA in the sample.

To increase the sensitivity of their nested PCR protocol, Mikovits turned to Max Pfost, a graduate student in her lab. Pfost researched PCR optimization and began modifying the protocol’s magnesium concentrations and annealing conditions, and choose primers for increased sensitivity rather than specificity. Mikovits allegorizes from what she calls “the HIV days,” when it was first discovered that multiple low–copy number HIV strains existed. “If you are looking for a low–copy number family member, you really have to optimize the magnesium and base everything on the annealing temperatures." Otherwise, she says, researchers using nested PCR would very likely overlook XMRV in their samples.

“A lot of people are just not taking the time to optimize their PCR,” says Pfost.

 

[cigana]

There seem to be a few general misunderstandings about what a replication study is...

There certainly does. I would define "replication" as using exactly the same techniques on exactly the same cohort. Cooperative seem to define it as something else.

Given that literally tens of thousands of papers have been published using PCR in general and it has become the gold standard for confirming the presence of any new virus...

How many new viruses have been discovered by PCR?

Rather than responding to the numerous errors...

Until I read this statement, I (as a complete beginner) thought the debate had been quite balanced. But now that "Cooperative" have decided not to respond to specific scientific criticism, I have become very suspicious of their credibility.


Thanks Jace for your posts.

 

[free at last]

Well i still think this will be settled with BWG phase 3, note how the false WPI positive is being used by cooperative as a indication that the WPIs testing methods might be flawed. Im afraid after so many positives in the Science paper, the WPI really do need to get most ( maybe not all ) but most of the blinded samples right, because if they can not, then this really does indicate a problem, and the figures for the science paper will be seen as suspect by most. I for one am rooting for the WPI and judy, because if they do well, ( better still very well ) then these kind of comments by cooperative will really be completly invalid. and what explanation will they have for that i wonder.

Im worried though that things wont go well, maybe becuse i so want the WPI to be right on this. Its kind of scary really. But still have faith in them. i would rather trust Judy than the CDC, cooperative Towers,Mcclure the list goes on, people can say what they like, but in subtle ways you can easily tell those that are hoping this falls flat on its face. They negatives think they are right, dont want to be proven wrong. and will feel like idiots if they are proven wrong. infact the more they say, the worse it will be, if the tide starts turning at any point, Im not saying it will. But i hope it does, for the WPI, and especially for the patients, Wish the likes of Frank russeti ila sing would speak out and give there opinion, just hope they are not shaken. that would really worry me. Ila sing remember her. Man those studys are taking long. that worries me too. Its not going our way folks. hope so badly that changes soon

 

[kurt]

Of course PCR is sensitive enough to detect XMRV, that is what WPI used. There seem to be some misunderstandings behind the criticisms of the negative XMRV studies, and that is what I believe Cooperative was attempting to address. Someone or maybe multiple CFS patients have been making continual conspiracy and/or incompetence claims of the negative study researchers over the past year, but they appear to lack some basic understanding of PCR techniques. At least that is what I believe Cooperative was trying to say. The criticisms just do not make sense, and I don't think they have time to untangle all the technical errors in every blog post, so they are going back to basics.

I am not a PCR expert but have followed this debate long enough to believe Cooperative is correct, the we need the equivalent of PCR 101. And I think the evidence is pretty clear that something is wrong in the XMRV studies, and eventually we will find out what that is.

This is my understanding about detecting a gamma retrovirus. The size of a virus is less important in PCR detection than the presence of the DNA. It is the DNA that the PCR technique evaluates, not the virus itself. In fact they extract the nucleic acids from the virus, break down the envelope, etc. So the arguments that these PCR tests lack sensitivity to detect a gamma retrovirus are fundamentally flawed. Of course they can detect the nucleic acids of a gamma retrovirus, all DNA strands are the same size. Goodness, my 12 year old son came home from school this week and told me that in science class he extracted DNA from saliva just using a few common chemicals. Extracting DNA is a simple process. The only challenge is the sensitivity of the test, if very small quantities of the nucleic acids are present, but these PCR tests used in ALL the XMRV studies have been capable of finding the level of XMRV infection claimed to be found by WPI. They can find low levels of VP62 in positive controls, that is how they all calibrate their tests, that is what WPI used to calibrate, what Cooperative used in their tests, what the CDC used in their tests, etc.

Exact replication of WPI's PCR test is less important than people realize, or have been led to believe by the XMRV conspiracy theorists. To precisely replicate, one would have to have the same humidity, altitude, reagent batches, samples, etc. PCR testing is very flexible so precise replication is not critical. There are HUNDREDS of valid PCR test designs for any given virus or retrovirus, there are dozens of HIV PCR tests on the market, for example. They can all find the DNA of the virus or retrovirus. The gold standard is simply to successfully calibrate your test, to find the antigen in blinded control samples. Cooperative, WPI, CDC, the others have all done that. These tests work, they find the viral DNA in the positive controls. At issue is whether there is contamination in clinical samples or reagents, not whether or not the tests work. So far nobody has validated WPI's claims, remember, the FDA found a different MuLV, and several labs at first believed they had all positives then later discovered contamination. Now there are hints of contaminated reagent lines. Given that controls HAVE generally been from different sources in these studies, including the original WPI study (convenient sample groups), contamination of some type is possible. There could be other explanations such as an interactions in the reagents. This has happened before repeatedly in prior retroviral hunts. And the fact that in the early BWG study WPI had a false positive in a negative control is not a good sign. I personally have no problem either way this goes, all I want is the truth, and I would like to see everyone put down the gloves and work this through rationally. The points I am personally persuaded of after many interactions with people involved in this issue is that there is no conspiracy, and the level of competence in all these studies is generally high. This is a scientific mystery and that is all.

 

[lansbergen]

This is my understanding about detecting a gamma retrovirus. The size of a virus is less important in PCR detection than the presence of the DNA. It is the DNA that the PCR technique evaluates, not the virus itself. In fact they extract the nucleic acids from the virus, break down the envelope, etc.

Go learn the retrovirus lifecycle. The virus has two stages. The virions and the provirus.

The virions have RNA. The provirus has DNA.

Virions have an envelope. Provirus has not.

Of course they can detect the nucleic acids of a gamma retrovirus, all DNA strands are the same size.

Are they?

 

[omerbasket]

Given that literally tens of thousands of papers have been published using PCR in general and it has become the gold standard for confirming the presence of any new virus (this isn’t the 1980’s anymore when HIV was discovered), none of the scientists are worried about whether PCR itself works or not. No one is asking the question, “Is PCR a valid technique?” Instead, they are asking, is there really XMRV DNA in 100 to 250 ng of PBMC DNA in CFS patients? If there is XMRV DNA in 100 to 250 ng of PBMC DNA extracted from the blood of CFS patients, then standard DNA detection methods (ie PCR) can be used to detect it (unless tens of thousands of papers and the entire modern clinical diagnostic field are wrong about PCR being a valid technique).

PCR is a very valid technique for a yes or no question regarding specific conditions. It's like a polygraph. If I'm being investigated because the police suspect that I have too much money in my bank account and therefore it must be stolen, and let's say that the police thinks that anything beyond 2,000 dollars for me is more than I should have had if I didn't still anything, and let's assume that I actually have 499,999 dollars in my account - if the polygraph guy asks me "Is it true that you have 500,000 dollars in your bank account" and I say: "No", the lie detector would probably show that I lied. So the police will then think that I have something to hide - because they have knowledge of me having about 500 thousand of dollars, and yet I say "No", and the polgygraph is showing that I lied. But what can I do - even though the money that I really have in my bank account would confirm what they are thinking, I really don't have 500,000 dollars there.
If PCR was able to find out if we have said the truth or not, the way it can find out if certain DNA/RNA strains are in a sample - we would have a much better machine then a polygraph in order to find out whether someone is telling the truth or whether that someone is lying. However, if the situation was as was the situation that I mentioned above, PCR would also say that I'm lying. And it would also be correct. And yet, it would also divert the police from the truth, since they really really don't care if I have 499,999 dollars or 500,000 dollars.

And we really dont care if the strain is GTTCGGATTCGGTTTCCCAAAAAT or GTTCGGGATTCGGTTTCCCAAAAAT. But with some PCR conditions, you might find the first strain - which would be the strain that you cloned in order to calibarate your assay, but not find the second strain, which might be the strain that was in the blood of the patient. Should the patient care if another G enters there, somewhere? Probably not, and it would probably have no effect, or a very very minor effect on the possibilities of treatment. But a PCR test might tell him that he doesn't have "XMRV", while infact he have a strain of XMRV (which is a name of more than one genetic strain) that this PCR test cannot find.

In other words, to scientists in the field, a replication of what Lombardi et al did means simply running a validated PCR for any XMRV gene on blood samples from persons with CFS using at least 100 to 250 ng of PBMC DNA (which is found in 300 to 750 ng of DNA from whole blood). Using different PCR tests is not a failure to replicate, but is actually what is required to replicate in a way that shows the scientific community that what Lombardi et al found was not due to contamination or false positives.

False and misleading. First of all, replication of the Lomardi et al study means to do every single test that they did, on patients meeting the exact same criteria. That mean Canadian Consensus Criteria, and performing each of the following:
- nested PCR for gag and env.
- Intracellular flow cytometry
- Western Blot.
- Isolating B and T cells from a patient and testing it for antibodies.
- Co-culture activated lymphocytes with LNCaP.
- Incubate LNCaP cells with plasma samples and check for XMRV and test by PCR and IFC.
- Check by flow cytometry if the blood is reacting with a mouse B cell line expressing recombinent SFFV Env and not with samples without SFFV Env.
- See if the plasma is blocking the binding of the SFFV Env mAb to SFFV Env on the cell surface.

But doing all these would still not be a replication study. Let's see what the dictionary can tell us about "replication":

a copy; biologythe production of exact copies of complex molecules, such as DNA molecules, that occurs during growth of living organisms.

So what does that tell us, kids? Right! Every test that we do must be done exactly as the WPI did it. Not "very much like", not "it's not the same but it should have worked". Exactly.
A replication study would mean to do the exact same things as were done in the first study, and do them all. Select the patients by the same criteria, take the same amount of blood that was taken from them in the first study, put it in the same kind of tubes, store it exactly the same, process it the same and check it the same. Some parts are almost impossible - they probably don't want to store those samples now for 2-3 years. But unless they did that, they cannot say that they have made a replication study. But while no one asks for the samples to be stored for 3 years before testing, we do ask for other things, that are very much possible to do: Choose patients by the same criteria; Process the samples exactly the same; Do all of the tests; And do the tests exactly as they were done by the WPI.

While every other month the authors of the Lombardi et al study seem to change their minds on the preferred method of detecting XMRV

Ugly. I believe that while Dr. Mikovits would be remembered as a great scientists in the history of the virology world, the persons who wrote this digusting letter would probably not be remembered at all, and if they would be remembered, they would be remembered as those that not only couldn't find XMRV even though it's very real, but also decided to throw mud at the scientist who discovered it's connection to ME/CFS and possibly other diseases too.

all they do is all built on the foundation of finding XMRV DNA in 100 to 250 ng of PBMC DNA. If the foundation of any structure is faulty, the entire structure collapses. Thus the other details mean nothing until the foundation has been proven solid.

The sentence about structures is correct, but the meaning behind this sentence is entierly misleading. I said it before, and I'll say it again: Let's say that you have a PCR test that would only find a virus if it has 99,236 nucletoides. You check a sample with a virus that have 99,238 nucleotides, and you don't find it. The difference of 2 nucletoides means nothing in reality, but the test would come back with a "negative" instead of a "positive". The WPI designed their tests in order to be able to find a virus that has many strains that are called together "XMRV". They tweaked their tests in order to find the best way to discover it. They also had luck. Let's say that they found the 99,236 nucleotides virus. Now, Cooperative Diagnostics is checking with a test that would find a virus if it has the exact 99,236 nucletoides in the same order. But what can we say, the virus has changed a little bit and instead of having a G somewhere after 40,000 nucleotides, it has a C there. Cooperative Diagnostics don't find it and say that there was not XMRV there. What are you telling me, that everytime that a nucleotide is changing in a virus we should call it by a different name? As the doctor who saved the lives of millions around the world said, it's not that HCV is one virus - it's a whole lot of similar viruses called by us humans by the same name.
It's not that their tests wouldn't recognize a virus if it had a single nucleotide change from 99,236 nucleotides. But it's also not that a retrovirus found in different time at different zones is expected to have a single nucleotide change and leave the other 99,235 nucleotides as they were.
PCR has it's limits, like all of the other assays - but some PCR assays have more limits regarding our certain case than others. Therefore, before you can even think to yourself that there is no XMRV here, you should perform the PCR test that was proven to be able to find XMRV in clinical samples before - because unlike when you calibarate your test with virus clones, in a clinical sample you don't know what the exact sequence is until you sequence the virus. And probably all of the 101 patients in the "Science" study had somewhat different sequences from one another, and a test that could find a certain sequence whenever it's there, might not be able to find a very very similar sequence, if it's too specific. In the study of Lo et al., and as we know also in the study of Dr. Hanson, they found somewhat different sequences, but that does not change anything important - because it can be expected, retroviruses mutate. Dr. Mikovits already showed in her lecture in January how one would not have found the Lo/Alter viruses using a certain PCR test, but would have found it using the test that the WPI developed after working very hard in order to do that.

But even if you work very hard in order to develope a PCR test that would found any MLV-like virus, your assay might still not be able to perform that. Since we don't know all the sequences out there, we cannot know that our assay detects them all. Or even most, or even 10% of them. Therefore, it's important to use other methods as well. And those methods should be able to find a very broad spectrum of MLV-like viruses as well. As I said, at least right now, it does not matter what you call it, as long as it's a MLV-like virus. 40% like the WPI's virus is not enough, but 85%, 90% is very very much enough.

Perhaps you will note that I mentioned the use of a “validated” PCR. It is important to define this word since it seems to cause a lot of confusion and means different things to different people. In the eyes of the FDA, there are no “validated” XMRV tests, because none has FDA approval. The type of validated test we are referring to is the acceptable “validation” process for use in research to be published in peer-reviewed literature. Specifically, the PCR must be able to detect a quantity of virus near the theoretical limit of a PCR reaction (ie 1 copy of viral DNA spiked into the sample type that will be tested). Since it is impossible to precisely add 1 virus at present, scientists settle for a close measurement of less than 10 to 20 copies. Such a test must also be checked to insure it does not have false positives. This has been done by every paper from Lombardi et al to all the negative studies.

Validated for what? GGCCTTAAACCCCCTGTTTGGG? Or GGCCTCAAACCCCCTGTTTGGG? So yes, you can validate that your assay would find GGCCTTAAACCCCCTGTTTGGG if it has about 10 copies there. But you can't validate that it would find any virus that is "only" 96% identical to your clone. and since 96% identical might very well be enough, that is of huge importance. So again, that is why you have to have a PCR that would discover a very braod spectrum of sequences, and to also test it by other ways.
For example: Dr. Singh found 6% of the prostate cancer patients that she tested to be positive for XMRV by a PCR test; But She also found another 21% to be positive for XMRV, or at least a gammaretrovirus, by immunohistochemistry. So what do Cooperative Diagnostics say, that all of these 21% that the PCR didn't find to be positive must be negative?

It is important to note that none of these are amateur scientists running experiments for the first time in their garage. Most have considerable experience in their field

So does Dr. Mikovits, with her 30 years experience in retrovirology. So does Dr. Hanson. So does the co-discoverer of HTLV-1, Dr. Francis Ruscetti. So does the co-discoverer of Hepatits C and Hepatitis C virus (and a contributer to the finding of HBV), the 75 years-old Dr. Harvey Alter.

and some may even be considered to be among the world’s most accomplished in the design of PCR diagnostics.

If you say that Drs. Ruscetti and Alter can be wrong, so does these doctors who are "among the wrold's most accomplished in the design of PCR diagnostics". It's only human. But it's more human with a method that might be too specific in order to find unknown strains of viruses.

So what the scientific community sees is that there is contradictory data with what are considered equally valid tests, 7 negative papers and one positive. There is no scientific consensus, at least not in support of XMRV association with CFS.

First of all, that's 2 positives, since the Lo/Alter paper clearly confirmed the WPI's findings, even if the sequences were only similar and not identical, and good virologists should know that it's likely that a retrovirus would mutate. Second of all - what kind of scientist begins to measure how much papers are in favour and how much oppose? It's like I've said many times: If I have VP62 on the floor, and I decide that if I will put some cola on that the floor would turn green - and I do that a hundred times and the floor stays white - that doesn't mean I don't have VP62 there. It means that my test couldn't find it. And if I have a virus that is 95% identical to VP62, but my test can only find a virus that is 95.1% identical to VP62, even if the test is perfect at finding these >=95.1% identical-to-VP62 strains, it would still say "negative", but the interpertation is not that there is no MLV-like virus there, the interpertation is that there is not 95.1%-identical-to-VP62 strain there.

It is not uncommon for a single peer-reviewed article to disagree with the original finding, but to have 100% of them disagree is historically a very bad sign

It's not 100% since the Lo/Alter paper is in agreement with the "Science" paper, which by itself checked his samples in 3 seperate laboratories, and the studies of Dr. Hanson and Dr. De-Merleir are also in agreement with the "Science" paper, and also the findings of VIP Dx and RED Laboratories are in agreement with the "Science" paper.

Add to that the other replication studies finding that what they originally thought were positives were actually contamination

These were not replication study and the fact that McClure and Huber did not take approapriate measures to avoid contamination says very little, if anything. The WPI clearly took great measures to show that it's not a contamination, as was also done in the Lo/Alter study.

the finding that what appeared to be XMRV integrated into human genomes in clinical samples was also a contaminant

No one found that it was a contaminant, if anything they just showed that it's, in their very biased opinion, likely, and I really tend to believe that many, more known and experienced researchers, would disagree with them.

and the fact that the Lombardi et al authors had a false positive in the only negative control in the preliminary blood working group study and you see the picture that most scientists are seeing now.

This was found to be a human DNA strain by the WPI itself, by sequencing, a process that they have done with any of the hundreds of positives that they found during the last 2 years. And if Dr. Simmons said he is not concerned with that, than why should I listen to Cooperative Diagnostics?

What picture do most scientists see now? I doubt if it's the picture that Dr. Mikovits, Dr. Francis Ruscetti, Dr. Sandra Ruscetti, Dr. Lo, Dr. Hanson, Dr. De-Merleir, Dr. Singh, the scinetists at VIP Dx, the scientists at RED Laboratories, the scinetists from the spainish hospital and many others see. I doubt if that's the picture that the discoverer of Hepatits C and Hepatits C Virus and the person that was awarded the Distinguished Service Medal, the highest award conferred to civilians in United States government public health service, the 2000 Albert Lasker Award for Clinical Medical Research and the American College of Physicians Award for Outstanding Work in Science as Related to Medicine (and that's not all of it), Dr. Harvey Alter, sees:

But I still want to counter by saying I think the current evidence for disease association is very strong, even though not universally confirmed. But it has been confirmed now in at least four studies, two of which were presented today, that either XMRV or a polytropic MLV is associated strongly with chronic fatigue syndrome. A point that I think was misrepresented today: In those labs who do find the agent, it is very reproducible. Judy has found the same patients to be positive by culture year after year. We have found a patient to come back after 15 years and still be positive. So this is not a single, isolated finding. It's confirmed by sequencing. It's reproducible over time.

Dr. Hanson has shown today how critical the assays are. When she tweaked her assay, she went from no findings to findings almost identical to the Lo lab. The diversity is now being confirmed also in the original WPI group. XMRV isn't the only agent even in the WPI lab.

Despite the very legitimate concern for contamination -- I think this is a serious issue -- there have been hundreds of negative controls in the same laboratory that are always consistently negative. An extremely sensitive mouse mitochondrial DNA has always been negative in the Lo laboratory. Lo has done the IPA assay that Dr. Coffin recommended. That is also negative. There just has been no evidence for contamination. Although you could say maybe the negatives could be negative somehow and the positives positive for contamination reasons, it really is not logical that that would be so.