Decentralized Genomic Diagnostics

[undiagnosed]

It's clear that the lack access to research assays is primarily political. Ultimately, this problem can be solved by decentralizing the laboratory technologies needed so that people don't need to get permission to perform research. I am starting to seriously investigate the minimum amount of time and money it would require to get a basic setup together to start working on some of my own research questions. The general applications I am interested in, as others here may be, are:

• Pathogen detection/discovery (nucleic acid amplification, reverse transcriptase activity)
• Genetic testing (carrier status, traits, etc.)

I've already found a number of commercially available and open source projects that seem to cover a lot of the requirements. So far, the most promising technology that I've come across is a Loop-Mediated Isothermal Amplification (LAMP) based assay. LAMP amplifies nucleic acids and has some advantages over Polymerase Chain Reaction (PCR). It does not require a thermocycler as the reaction takes place at a constant temperature. Also, the results can be viewed by fluorescent measurement without the need to perform a gel electrophoresis as in traditional PCR readouts. Additionally, it may be possible to integrate a reverse transcriptase activity capability by incorporating a prior phase which would generate DNA to be amplified from RNA in the presence of reverse transcriptase. Assays along these lines have been done and are called Reverse Transcription Loop-mediated Isothermal Amplification (RT-LAMP).

There was an open source project done called the uBAR using LAMP.

The authors claim prototype units can be built for $919 in single unit quantities. The unit automates analysis by using microfluid catridges. While this is ideal for a end user point-of-care application, it is overkill in a research setting where experimentation is taking place. Therefore, the design could be simplified. The main issue is that there doesn't appear to be any off the shelf option that is affordable. Building a device could be done affordably but would require more time and access to a calibration device.

There are other options that are available off the shelf such as the minipcr. A starter kit can be purchased for $1250 that includes the PCR thermocycler, electrophoresis visualization system and miscellaneous lab supplies. However, this system being PCR has some disadvantages compared to LAMP as described above.

I am still doing a survey as there is a lot of information out there. Just wondering if anyone else has looked into this at all and had any input. Would anyone be interested in getting involved whether through help with research, funding, etc?

Some of the initial applications I am specifically interested in are:

• Retrovirus detection / discovery
• Medical marijuana yeast and mold detection

 

[undiagnosed]

I found a review paper that had a table of prices for commercial integrated LAMP machines as shown below.

You can see that most of the prices are too high to be conducive to widespread decentralization. With commercial possibilities for an integrated machine out of the picture at this time, I looked into approaches used in minimum resource settings and in the field. There has been a lot of work in this area. One effort which used LAMP for malaria diagnosis in a field setting was able to get results using a water bath to incubate the samples for the LAMP reaction and then detect with the naked eye whether the sample was positive of negative. While the detection methodology could be prone to subjectivity, the experiment demonstates how basic a LAMP setup can be. It should be fairly straightforward to perform the LAMP reaction using standard kitchen supplies such as a pot filled with water on a stove top with a thermometer, timer, and tube rack to hold the samples. The result could then be visualized with the naked eye. While this approach may not work sufficiently in some cases, it could be a fast and cheap starting point. Below is a visualization of an example setup.

Note that this setup is for the LAMP reaction/detection and does not include items needed for sample collection, extraction, or the reagents and primers for LAMP. I will be investigating minimum configurations for these items as well.

 

[undiagnosed]

I've been looking into primers a bit to understand the costs involved. Six primers are used in typical LAMP reactions. Using primer data from this paper which detected HIV-2 subtypes using a RT-LAMP assay, I got quotes from a few companies to create the primers. Below are the primers included in the quotes.

HIV-2 Subtype A Primers (5' to 3')

F3 CCTTACAATCCACAAAGCCAA
B3 ATTGTATTTCTTGTTCTGTGGTG
FIP CTGTATTTGCCTGYTCTCTAATTCTTTTTTAGTAGAAGCAATGAATCACC
BIP AGTACTAATGGCAGTTCATTGCATGTTTTGTCTTTCTGCTGGGGTCAT
Loop F ACTTATCTGATTTTTTAG
Loop B HEX-AATTTTAAAAGAAGGGGAGGA

From the paper, the primers were used in the following concentrations in a total reaction volume of 25uL.

0.2 uM each F3 and B3 primers
1.6 uM each FIP and BIP primers
0.8 uM each Loop F and Loop B

Converting from micromolar to picomoles, we get the following amount of primers for a 25 uL reaction:

0.2 uM: 0.2 pmol/uL * 25 uL = 5 pmole
1.6 uM: 1.6 pmol/uL * 25 uL = 40 pmole
0.8 uM: 0.8 pmol/uL * 25 uL = 20 pmole

The minimum order quantity from the companies that quotes were requested from was 25 nmole. Given 25 nmole, under ideal conditions, this would allow for 5000 reactions with the F3 and B3 primers, 625 reactions with the FIP and BIP primers, and 1250 reactions with the Loop F and Loop B primers.

Below are the quotes from various manufacturers:

ThermoFisher Standard Oligos Pay per Base, 25 nmole dry, tubes

F3 $6.72
B3 $7.36
FIP $16.00
BIP $15.36
Loop F $5.76
Loop B $6.72 w/o HEX, $78.97 w/ HEX

$57.92 for all 6 primers

Sigma-Aldrich DNA Oligos in tubes 25 nmole dry

$57.92 for all 6 primers

Integrated DNA Technologies in tubes 25 nmole dry

$66.97 for all 6 primers

It would be possible to use economy service if primers were shorter (<= 40 mers) which would reduce the price further. Also, note the significant cost associated with adding the HEX fluorescent modification to the Loop B primer. This should be avoided for costs savings and if possible turbidity from the reaction should be used for detection to avoid costly modifications.

Overall, the cost associated with developing a set of primers for a LAMP reaction are reasonable and within reach for DIY researchers. There are however some other equipment requirements for resuspension, dilutions, and storage of the primers. The primers are shippped as a dry powder. In order to prepare the primers for a reaction, they need to be resuspended, typically in TE buffer. The TE buffer costs will be considered in a following post that deals with reagents. However, in order to properly resuspend, liquid volume measurements need to be made, which is typically done with a micropipette. Good micropipettes can be expensive. The cheapest set covering most of the volume measurement requirements I found are from minipcr and are $150 as shown below. Tips will be needed as well.

It may be possible to to work with less than 3 micropipettes depending on the volume measurement requirements. Thus far, the micropipette set is the most expensive equipment that would have to be purchased. It is a one time cost and is still a manageable cost. I will keep an eye out to see if there are any ways to reduce the cost further without sacrificing integrity of the measurement.

The ideal storage conditions for the primers are dried or resuspended in TE buffer and frozen at –20°C (-4°F). The primers will be stable for at least 24 months in these conditions. My standard kitchen freezer temperature goes down to -4°F and would support this. However, if a freezer is not available it would still be possible to order primers and run experiments. Primers stored at 37°C are stable for at least 6 weeks in water, or 25 weeks dried down or in TE. So there is no additional costs associated with storage of the primers.

 

[undiagnosed]

I did a little experiment to test the premise of using a pot with water on a stove as the incubator for a LAMP reaction. I mainly wanted to see how difficult it would be to reach a target temperature and remain stable at that temperature. The image below shows the configuration used in the experiment.

A pot with a diameter of 16.5 cm and a depth or 10 cm was filled with roughly 7 cups (1.66 L) of water giving a water depth of approximately 7.2 cm. A thermocouple temperature probe from a multimeter was positioned 2.5 cm from the bottom of the pot in the center. This was an estimate for where the bottom of the tubes would be positioned when using a floating tube rack.

The image below shows a plot of the temperature over time.

The target temperature was 65 deg C. The water started out at room temperature with the stove off. After roughly 1 minute, the stove was turned to the High setting. After about 7 minutes, the stove setting was changed to 5 at a temperature of 63 deg C. At 8.5 minutes the setting was changed to 3 at a temperature of 72 deg C. At 9.5 minutes the setting was changes to 2. At 10.5 minutes, the setting was changed to OFF at 76 deg C. The target temperature of 65 deg C had been overshot and the temperature will need to be turned down at a lower temperature in the future to avoid this. The temperature was allowed to drop until 23.5 minutes when the setting was changed to 2 at a temperature of 68 deg C. After that point the setting was adjusted between 1 and 2 and the temperature was able to be stabilized within a few deg C.

I am not sure how sensitive the LAMP reaction is to temperature fluctuations, however people have had success in water baths which in principle operate the same way, but have a better control system for managing the temperature. In any case, it is possible using this method to stabilize within a few deg C of the target temperature.

 

[undiagnosed]

I've been doing some research regarding detecting reverse transcriptase activity with a RT-LAMP apparatus. The purpose is to see if it would be possible to use a one-pot assay with a whole blood sample to detect reverse transcriptase activity with a useful clinical sensitivity. A number of commercially available reverse transcriptase activity assays use an ELISA type process requiring a plate reader, plate washer, shaker, and other equipment. The process is outlined in the figure below.

Source
​

A template and primer are used which in the presence of reverse transcriptase will synthesize cDNA. The BrdUTP nucleotides used means that an antibody can bind to the synthesized cDNA which can then be quantified by colormetric detection.

Another method that works in principle more like a RT-LAMP assay detects reverse transcriptase activity indirectly by monitoring the production of pyrophosphate which is a byproduct of DNA synthesis. In this method, a template and primer are used which will produce cDNA and therefore pyrophosphate in the presence of reverse transcriptase. This particular RT assay used luciferase for bioluminometric detection. Using this method, the assay had a limit of detection of 1.5 mU when using AMV reverse transcriptase. The reaction equations are shown below.

Source
​

You can see the similarity to the LAMP detection method which is also based on the production of pyrophosphate when amplicons are synthesized during amplification. The reaction equations and how different detection methods work are shown below.

Source
​

In LAMP, the generated pyrophosphate combines readily with metal ions such as magnesium. This can then be detected in various ways. The same technique of detection should be able to detect reverse transcrtiptase activity instead of the luciferase detection method. If amplification of the reverse transcribed DNA is also performed, it should be possible to lower the limit detection. It may also make it possible to detect RT activity without a complex extraction process. It has been found that humans have RT-Abs which inhibit RT activity in blood making it difficult to detect without complex preprocessing. The main question to explore is whether it could be detected using a more simple preprocessing step such as heat treatment. In one study, HIV RNA and DNA was detected without performing RNA extraction and just using a simple heat treatment step. LAMP is more robust than PCR and the reaction is not impeded by many compounds in blood. Therefore, it is well suited to explore the possibility of detection from whole blood samples.

Another area that needs to be looked at is what are the design considerations to use when selecting a template and primer for detecting reverse transctiptase activity. In the luciferase RT assay , the following oligonucleotides were used:

template:
CGACGATCTGAGGTCATAGCTGTTTCCTGTGTGAACTGGCCGTCGTTTTACAACG

primer:
CGTTGTAAAACGACGGCCAGT

However, there was no rationale describing how the particular template was selected. That is an area that will need to be investigated further.