XMVR Mutation rates and WPI decision to abandon PCR for identification

[gerwyn morris]

Retroviruses mutate at a very high rate

The rate is between ten to the power of minus 4 to ten to the minus 6 mutations per base pair per replication

The recombination rates are also very high at about 4% Manskey L,Journal of General Virology(1998),79,1337-1345

This applies across all retroviruses reviewed up to the point of the study so should also apply to XMRV

There are a number of implications

PCR---Is probably an unreliable assay method------The WPI position appears to be a lot more science than spin

The age of the blood samples are probably crucial

Mutations could slow down the replication rate to such a degree that XMRV could be very difficult to detect in an extracellular environment such as sera for example

Different serotypes could well evade evade monoclonal antibody detection

Gag initiation is thought to be initiated by as little as twelve base sequences. Mutations causing a difference of base sequences in this region would again affect the replicative viability of the virus

The only reliable indicator for XMRV which seperates it from endogenous virus is a deleted sequence in the env gene which should be relatively stable- I ,m dashed if i can remember the name of this deletion

In short if the WPI have a reliable method for whole virus cultivation then stick with it because there may be no other way of positive conformation This Virus seems to be a tricky beast!

 

[DysautonomiaXMRV]

Thanks for the post.

A small point. I believe it's called PCR not PCI

Does it look like to be diagnosed with XMRV in 2010/11, one will need a culture test to show infection, and maybe (additionally) an antibody test to show an immune response to the infection?

I'm having a wild guess the XMRV antibody test be a simple 'cheap/fast' way of screening for XMRV first, and then if positive one would have a culture test second to confirm?

 

[gerwyn morris]

Thanks for the post.

A small point. I believe it's called PCR not PCI

Does it look like to be diagnosed with XMRV in 2010/11, one will need a culture test to show infection, and maybe (additionally) an antibody test to show an immune response to the infection?

I'm having a wild guess the XMRV antibody test be a simple 'cheap/fast' way of screening for XMRV first, and then if positive one would have a culture test second to confirm?

Thank you I hadn,t noticed if you can change it i,d be grateful I dont know how------As for everything else yes i agree

 

[_Kim_]

Thank you I hadn,t noticed if you can change it i,d be grateful I dont know how------As for everything else yes i agree

gerwyn, I've changed the thread title to PCR. Should this happen again, just send one of the Moderators or Administrators a Private Message with a request to modify the title.

 

[Esther12]

I'd be interested to hear what any other science bods have to say about this.

What are the downsides of culture over PCR? My understanding was that it would be very surprising if the XMRV virus mutated in certain key aspects (the ones the london study PCR looked for), as these are fairly vital for the operation of the virus. At the time of the Science paper, the use of PCR seemed to be seen as especially compelling evidence that they had found XMRV - if they've now decided PCR works less well than culture tests, does that mean they could have found somthing other than XMRV? Maybe I should give up on trying to understand all this, but it's hard to leave it alone when you're so involved.

 

[gerwyn morris]

I'd be interested to hear what any other science bods have to say about this.

What are the downsides of culture over PCR? My understanding was that it would be very surprising if the XMRV virus mutated in certain key aspects (the ones the london study PCR looked for), as these are fairly vital for the operation of the virus. At the time of the Science paper, the use of PCR seemed to be seen as especially compelling evidence that they had found XMRV - if they've now decided PCR works less well than culture tests, does that mean they could have found somthing other than XMRV? Maybe I should give up on trying to understand all this, but it's hard to leave it alone when you're so involved.

The reading frame could shift at any points quite randomly GAG pol etc are diagnostic of retroviruses but not neccessarily of any particular virus----thats my understanding anyway

 

[Samuel]

The reading frame could shift at any points quite randomly GAG pol etc are diagnostic of retroviruses but not neccessarily of any particular virus----thats my understanding anyway

I'm not sure I understand how this is a reply to her
question, so let me clumsily try to understand it out loud,
and you can tell where I am wrong.

A reading frame shift is like this:

--ACTGACTGACTGACTGACTGACTG
--^ start reading here, resulting in
ACTGACTGACTGACTGACTGACTG (or products of that sequence)

--ACTGACTGACTGACTGACTGACTG
---^ start reading here, resulting in
CTGACTGACTGACTGACTGACTG (or products thereof)

Of course those are fake base sequences and probably make no
sense as codon sequences.

Gag, pol, env, etc. are regions in retrovirus DNA. They
code for different parts of the retrovirus.

PCR amplifies sequences so that they can be analyzed. If
its reading frame shifts, you get a different sequence and
you could get false matches. Is this what you mean? If so,
I guess that either the match sequence is short, or there
are a lot of shifted sequences lying around normally.

Otherwise false positives would be rare modulo conserved
sequences in different species including HERVs. Do we have
a fairly decent handle on those issues?

Or do you mean, not PCR, but reading for replication? I
have heard that part of HIV is capable of being read in 3
different frames, which is interesting.

In any case, you seem to be saying that PCR is not specific. Was this known before?

Also, you seem to be saying that retroviruses mutate a lot. If the rate is as you say, a retrovirus of on the order of 1e4 bases would mutate in 100 replications by 1 to 100 bases. That seems surprisingly high. Didn't Coffin say at CFSAC that the differences from the wild retrovirus were relatively small? I am trying to reconcile those points. Or is HIV just higher than even that? If so, it sounds like PCR is trickier than we might have thought. On a practical note, can we learn from feline leukemia virus about mutation rate and resistance to antiretrovirals? What about PCR specificity?

I have insufficient knowledge about the topic, so this is
probably wrong, but I hope it leads to understanding when
you correct it.

My opinion: don't leave it alone, Esther. We all need to
learn about politics, history, and more, and if not
molecular biology, retrovirology, immunology, cytokines, and
more, then at least their clinical and epidemiological
consequences.

 

[Hope123]

My impression from my past bio backgroun was that culture was the gold standard test against which other tests (like PCR) would be measure. But culture is difficult and time-consuming to process so other tests are often used instead. However, viral culture is often used at the beginning of research for a better test.

This thought along with the higher percentages of positives I've see in various sites for culture vs. PCR for XMRV (the higher sensitivity that WPI is talking about) leads me to believe that is why WPI is offering culture only until a better PCR or other test is available.

I'm surprised few scientists have brought up what the idea of culture (or pathologic specimens) as gold standard -- Dr. Bateman finally mentioned this today during the webinar.

 

[starryeyes]

HIV mutates very fast and XMRV hasn't mutated at all. At least not the XMRV found in PWC. The WPI say it's exactly the same person to person. I think this is turning the standard testing in retrovirology on its head.

 

[Esther12]

I think this is turning the standard testing in retrovirology on its head.

We'll have to wait and see, but this worries me. I really hope this works out, but I'm feeling a less hopeful as more scraps of information come out. I really want to see some results from blinded replication studies!

 

[usedtobeperkytina]

Well, this doesn't seem to match what Coffin said, that the virus doesn't replicate a lot, XMRV that is, and that the virus doesn't change hardly at all.

Tina

 

[starryeyes]

That's what I said Tina. Whom are you addressing?

Mikovits said that XMRV was virtually the same from person to person with CFS.

 

[Knackered]

Mikovits said that XMRV was virtually the same from person to person with CFS.

Surely that's a good thing right? Wouldn't it make it much easier to treat?

 

[gerwyn morris]

I'm not sure I understand how this is a reply to her
question, so let me clumsily try to understand it out loud,
and you can tell where I am wrong.

A reading frame shift is like this:

--ACTGACTGACTGACTGACTGACTG
--^ start reading here, resulting in
ACTGACTGACTGACTGACTGACTG (or products of that sequence)

--ACTGACTGACTGACTGACTGACTG
---^ start reading here, resulting in
CTGACTGACTGACTGACTGACTG (or products thereof)

Of course those are fake base sequences and probably make no
sense as codon sequences.

Gag, pol, env, etc. are regions in retrovirus DNA. They
code for different parts of the retrovirus.

PCR amplifies sequences so that they can be analyzed. If
its reading frame shifts, you get a different sequence and
you could get false matches. Is this what you mean? If so,
I guess that either the match sequence is short, or there
are a lot of shifted sequences lying around normally.

Otherwise false positives would be rare modulo conserved
sequences in different species including HERVs. Do we have
a fairly decent handle on those issues?

Or do you mean, not PCR, but reading for replication? I
have heard that part of HIV is capable of being read in 3
different frames, which is interesting.

In any case, you seem to be saying that PCR is not specific. Was this known before?

Also, you seem to be saying that retroviruses mutate a lot. If the rate is as you say, a retrovirus of on the order of 1e4 bases would mutate in 100 replications by 1 to 100 bases. That seems surprisingly high. Didn't Coffin say at CFSAC that the differences from the wild retrovirus were relatively small? I am trying to reconcile those points. Or is HIV just higher than even that? If so, it sounds like PCR is trickier than we might have thought. On a practical note, can we learn from feline leukemia virus about mutation rate and resistance to antiretrovirals? What about PCR specificity?

I have insufficient knowledge about the topic, so this is
probably wrong, but I hope it leads to understanding when
you correct it.

My opinion: don't leave it alone, Esther. We all need to
learn about politics, history, and more, and if not
molecular biology, retrovirology, immunology, cytokines, and
more, then at least their clinical and epidemiological
consequences.

The figures for mutation rates ec appear robust Coffin was a contributer----i,ve referenced the work .if correct PCR will amplyfy what you have , you would have to amplify the whole genome not just gag and upwards like some studies

without a known +ve blood control of the same age you could not be certain thet you had the XMRV gag for example .reverse transcriptase could shift the reading frame by two bases for example or do a jump----sorry for the unscientific term

My point is really that reverse transcriptase can convey unpredictable variation both in magnitude and position.Some workers are adamant that eventhough the differences beween xmrv and endgenous viruses are small .as per Dr coffins assertation they are not consistent they maintain that the only consistent difference is the deletion in the env gene

The presence of different strains in different samples and in different parts of the world appear likely-------A low titre of whole virus particles seems equally likely-----A twelve base sequence in Gag seems essential for relication---there doesnt seem to be any redundancy here-----if you have time please have a look at the Mansky study-------I think the conclusion would be that the Jury,out----something is making the WPI distance its self from PCR and they imply issues of unreliablity

 

[joyscobby]

[/QUOTE]The presence of different strains in different samples and in different parts of the world appear likely-------A low titre of whole virus particles seems equally likely-----A twelve base sequence in Gag seems essential for relication---there doesnt seem to be any redundancy here-----if you have time please have a look at the Mansky study-------I think the conclusion would be that the Jury,out----something is making the WPI distance its self from PCR and they imply issues of unreliablity[/QUOTE]



I am not as good,as some, on the boffin stuff but since there have been samples sent from the UK could this of helped clarify this?

Could this be helping clarify any possible geographic differences etc. ?

There are at least 2 positives, by culture, so far that we know of.

 

[Mithriel]

PCR is very tricky. It is fine in theory, difficult in practice.

Diagnostically, there are tests that have been worked out and are sold commercially, then there are ones such as flu where the tests use more local things and you have to work out what results mean from complicated graphs (I can't remember the details, sorry). There are also bugs which they can't get PCR to work for yet.

The advantage of PCR is that once you have the expensive equipment and a commercial test you basically put the sample in one end and get a result out the other.

However, PCR works best when viruses are replicating. AIDS patients have their blood tested to see if the drugs which prevent replication are working. If XMRV doesn't replicate very much it will be harder to detect by PCR and harder to treat because antiretrovirals work when the virus is detached as it is replicating.

Culture is always difficult because you have to keep the tissue alive, but it proves definitively that there is an infectious organism present. Culture can show there is something damaging there even if you don't know what it is.

I think they were talking about developing a Western Blot test. These are used a lot diagnostically.

The difference between a research tool and a diagnostic test is vast.

Getting results from different tests is actually a good thing and is proof of XMRV rather than throwing any doubt on it.

These are living systems and there are always problems with those, don't give up on it yet.

Mithriel

 

[gerwyn morris]

PCR is very tricky. It is fine in theory, difficult in practice.

Diagnostically, there are tests that have been worked out and are sold commercially, then there are ones such as flu where the tests use more local things and you have to work out what results mean from complicated graphs (I can't remember the details, sorry). There are also bugs which they can't get PCR to work for yet.

The advantage of PCR is that once you have the expensive equipment and a commercial test you basically put the sample in one end and get a result out the other.

However, PCR works best when viruses are replicating. AIDS patients have their blood tested to see if the drugs which prevent replication are working. If XMRV doesn't replicate very much it will be harder to detect by PCR and harder to treat because antiretrovirals work when the virus is detached as it is replicating.

Culture is always difficult because you have to keep the tissue alive, but it proves definitively that there is an infectious organism present. Culture can show there is something damaging there even if you don't know what it is.

I think they were talking about developing a Western Blot test. These are used a lot diagnostically.

The difference between a research tool and a diagnostic test is vast.

Getting results from different tests is actually a good thing and is proof of XMRV rather than throwing any doubt on it.

These are living systems and there are always problems with those, don't give up on it yet.

Mithriel

I agree with comments about PCR XMVR might have been genotypically identical in the WPI studies----i,m not sure how they assessed that------Unless XMRV is completely different from all other known retroviruses in terms of its mutation and recombination rates then we are talking about drift and possibly even shift.Being virtually the same from person to person does not mean identical bearing in mind that" virually the same" is the same kind of description as Dr coffin used when describing the differences between XMRV and endogenous viruses -using more positive language admittedly-----It may indeed not mutate much in freshly drawn samples but what about over time place etc------the work has not yet been done.A low rep rate and the variable viability of tissue samples eg whether they have been frozen or not would seem to make PCR a lot less reliable than culture.p.s I hope that XMRV is consistent over time place etc but it would have to be unique amoung retroviruses to achieve that----Just ask anyone who tries to design new drugs to combat these beasts

 

[gerwyn morris]

PCR again

PCR is very tricky. It is fine in theory, difficult in practice.

Diagnostically, there are tests that have been worked out and are sold commercially, then there are ones such as flu where the tests use more local things and you have to work out what results mean from complicated graphs (I can't remember the details, sorry). There are also bugs which they can't get PCR to work for yet.

The advantage of PCR is that once you have the expensive equipment and a commercial test you basically put the sample in one end and get a result out the other.

However, PCR works best when viruses are replicating. AIDS patients have their blood tested to see if the drugs which prevent replication are working. If XMRV doesn't replicate very much it will be harder to detect by PCR and harder to treat because antiretrovirals work when the virus is detached as it is replicating.

Culture is always difficult because you have to keep the tissue alive, but it proves definitively that there is an infectious organism present. Culture can show there is something damaging there even if you don't know what it is.

I think they were talking about developing a Western Blot test. These are used a lot diagnostically.

The difference between a research tool and a diagnostic test is vast.

Getting results from different tests is actually a good thing and is proof of XMRV rather than throwing any doubt on it.

These are living systems and there are always problems with those, don't give up on it yet.

Mithriel

I agree with comments about PCR XMVR might have been genotypically identical in the WPI studies----i,m not sure how they assessed that------Unless XMRV is completely different from all other known retroviruses in terms of its mutation and recombination rates then we are talking about drift and possibly even shift.Being virtually the same from person to person does not mean identical bearing in mind that" virually the same" is the same kind of description as Dr coffin used when describing the differences between XMRV and endogenous viruses -using more positive language admittedly-----It may indeed not mutate much in freshly drawn samples but what about over time place etc------the work has not yet been done.A low rep rate and the variable viability of tissue samples eg whether they have been frozen or not would seem to make PCR a lot less reliable than culture.p.s I hope that XMRV is consistent over time place etc but it would have to be unique amoung retroviruses to achieve that----Just ask anyone who tries to design new drugs to combat these beasts

 

[starryeyes]

Surely that's a good thing right? Wouldn't it make it much easier to treat?

Sorry to say but she said this may make it harder to treat. We'll just have to see. It's certainly very different from HIV which mutates rapidly in each person so the drugs and methods developed to combat HIV probably won't work very well against XMRV.

 

[Katie]

Sorry to say but she said this may make it harder to treat. We'll just have to see. It's certainly very different from HIV which mutates rapidly in each person so the drugs and methods developed to combat HIV probably won't work very well against XMRV.

I think the qualifier is 'harder to treat with currently available medication' rather than harder to treat altogether. If XMRV is pathogenic, then the pharmacutical companies will need to develop a new technique and strategy to deal with our slow and lazily replicating retrovirus. Lol, XMRV is a malingerer