I am stupid. And it's clinically proved: My IQ dropped by about 45 points due to ME/CFS, at least as to one clinical psychologist who tested me few years ago. 
-
Phoenix Rising needs funds to operate: please consider donating to support PR
G
I am stupid. And it's clinically proved: My IQ dropped by about 45 points due to ME/CFS, at least as to one clinical psychologist who tested me few years ago.
Hi, it was not so much a problem of "computational intensity" but a problem with Internet connectivity. I have better Internet connection at work so I tried to find in the human genome any subsequence of the XMRV of length 30. There are precisely 8156 subsequences of the XMRV of length 30 and none of them matches any part of the human genome. I don't know what the biological interpretation would be but I suspect it indicates that XMRV is a relatively novel virus so that not many parts of it got incorporated in the human genome. I am not a biologist but if I recover I promise that I will become one and I will devote all the rest of my life to debunking all the psychosomatic filth.
I found out that there are some freeware libraries in R that are suitable to the study of phylogenetic trees. I will look at it, if I have enough energy.
I found out that there are some freeware libraries in R that are suitable to the study of phylogenetic trees. I will look at it, if I have enough energy.
G
Alesh If you are up to it can you let me know the % correspondence of the base sequences of xmrv with the human genome
The sequence of length 29:
GTAGACACCTTCTCTGGCTGGGTAGAGGC at (Chromosome3, 1), (16786152, 16786180)
This is one of the longest subsequences, i.e., of length 29. I will look tomorrow if there is any other of this length.
GTAGACACCTTCTCTGGCTGGGTAGAGGC at (Chromosome3, 1), (16786152, 16786180)
This is one of the longest subsequences, i.e., of length 29. I will look tomorrow if there is any other of this length.
There is no other such sequence, so GTAGACACCTTCTCTGGCTGGGTAGAGGC, is the only longest one corresponding precisely to a part of human genome.
Also look here:
http://www.wolframalpha.com/input/?i=GTAGACACCTTCTCTGGCTGGGTAGAGGC
Also look here:
http://www.wolframalpha.com/input/?i=GTAGACACCTTCTCTGGCTGGGTAGAGGC
Hey George, you are all ahead of me on this, but your speculation here caught my eye, I am not sure we all can't get colds. Plus, what I recall is unlike other virus making loads of copies and spewing them forth, XMRV is happy to take over a cell and spew just viral proteins.
That got me thinking about a hunch I had reading Devin Starlanyl's book on FM regarding the fascia and ground substance, it makes the cell wall and cell cytoskeleton as well. FM may originate in the fascia from a paper from OHSU, there are about a dozen or so proteins making up these tissues.
It is likely mitochondrial dysfunction, per Myhill, is a core problem with CFS, the mitos are old and few and therefore function poorly to produce ATP, they seem not to go into Apoptosis properly. So I check on how apoptosis is supposed to function, for some reason a process called blebbing causes the decoupling of the cytoskeleton from the plasma membrane, the cytoskeleton breaks up.
Soooo... My speculation is that something is inhibiting that process, could it be that the body is taking up 'like' proteins that are not working properly? Your cells have "fibro?" :scared: So actually I prefer your first speculation as fitting my hunch. Or maybe some kind of blebbistatin is produced?
Okay I am :sleepy: and I have a :headache: time to go :In bed:
I like you guys are on the case!
That got me thinking about a hunch I had reading Devin Starlanyl's book on FM regarding the fascia and ground substance, it makes the cell wall and cell cytoskeleton as well. FM may originate in the fascia from a paper from OHSU, there are about a dozen or so proteins making up these tissues.
It is likely mitochondrial dysfunction, per Myhill, is a core problem with CFS, the mitos are old and few and therefore function poorly to produce ATP, they seem not to go into Apoptosis properly. So I check on how apoptosis is supposed to function, for some reason a process called blebbing causes the decoupling of the cytoskeleton from the plasma membrane, the cytoskeleton breaks up.
Soooo... My speculation is that something is inhibiting that process, could it be that the body is taking up 'like' proteins that are not working properly? Your cells have "fibro?" :scared: So actually I prefer your first speculation as fitting my hunch. Or maybe some kind of blebbistatin is produced?
Okay I am :sleepy: and I have a :headache: time to go :In bed:
I like you guys are on the case!