Help please - need genetic map of XMRV with all the base sequences



Does anyone have access to the genetic map of XMRV with all the base sequences,any information about its insertase enzyme and any info on insertion sites within the human genome.Any help would be greatly appreciated Thankyou


Need something fetched (grins)

LOCUS NC_007815 8185 bp ss-RNA linear VRL 08-DEC-2008
DEFINITION Xenotropic MuLV-related virus VP62, complete genome.

SOURCE Xenotropic MuLV-related virus VP62
ORGANISM Xenotropic MuLV-related virus VP62
Viruses; Retro-transcribing viruses; Retroviridae;
Orthoretrovirinae; Gammaretrovirus.
REFERENCE 1 (bases 1 to 8185)

AUTHORS Urisman,A., Molinaro,R.J., Fischer,N., Plummer,S.J., Casey,G.,
Klein,E.A., Malathi,K., Magi-Galluzzi,C., Tubbs,R.R., Ganem,D.,
Silverman,R.H. and DeRisi,J.L.

TITLE Identification of a novel Gammaretrovirus in prostate tumors of
patients homozygous for R462Q RNASEL variant



gene 613..2223
CDS 613..2223
/product="putative gag polyprotein"

misc_feature 5479..5487
/note="splice acceptor"
gene 5754..7691
CDS 5754..7691
/product="putative envelope polyprotein"
LTR 7726..8184
/note="3' LTR"
repeat_region 7726..8115
protein_bind 7915..7929
/note="androgen response element (ARE)"
CAAT_signal 8027..8031
TATA_signal 8084..8090
repeat_region 8116..8184
polyA_signal 8162..8167
polyA_site 8185
1 gcgccagtca tccgatagac tgagtcgccc gggtacccgt gttcccaata aagccttttg
61 ctgtttgcat ccgaagcgtg gcctcgctgt tccttgggag ggtctcctca gagtgattga
121 ctacccagct cgggggtctt tcatttgggg gctcgtccgg gattcggaga cccccgccca
181 gggaccaccg acccaccgtc gggaggtaag ccggccggcg atcgttttgt ctttgtctct
241 gtctttgtgc gtgtgtgtgt gtgccggcat ctaatcctcg cgcctgcgtc tgaatctgta
301 ctagttagct aactagatct gtatctggcg gttccgcgga agaactgacg agttcgtatt
361 cccggccgca gccctgggag acgtcccagc ggcctcgggg gcccgttttg tggcccattc
421 tgtatcagtt aacctacccg agtcggactt tttggagtgg ctttgttggg ggacgagaga
481 cagagacact tcccgccccc gtctgaattt ttgctttcgg ttttacgccg aaaccgcgcc
541 gcgcgtctga tttgttttgt tgttcttctg ttcttcgtta gttttcttct gtctttaagt
601 gttctcgaga tcatgggaca gaccgtaact acccctctga gtctaacctt gcagcactgg
661 ggagatgtcc agcgcattgc atccaaccag tctgtggatg tcaagaagag gcgctgggtt
721 accttctgtt ccgccgaatg gccaactttc aatgtaggat ggcctcagga tggtactttt
781 aatttaggtg ttatctctca ggtcaagtct agagtgtttt gtcctggtcc ccacggacac
841 ccggatcagg tcccatatat cgtcacctgg gaggcacttg cctatgaccc ccctccgtgg
901 gtcaaaccgt ttgtctctcc taaaccccct cctttaccga cagctcccgt cctcccgccc
961 ggtccttctg cgcaacctcc gtcccgatct gccctttacc ctgcccttac cccctctata
1021 aagtccaaac ctcctaagcc ccaggttctc cctgatagcg gcggacctct cattgacctt
1081 ctcacagagg atcccccgcc gtacggagca caaccttcct cctctgccag ggagaacaat
1141 gaagaagagg cggccaccac ctccgaggtt tccccccctt ctcccatggt gtctcgactg
1201 cggggaagga gagaccctcc cgcagcggac tccaccacct cccaggcatt cccactccgc
1261 atggggggag atggccagct tcagtactgg ccgttttcct cctctgattt atataattgg
1321 aaaaataata acccttcctt ttctgaagat ccaggtaaat tgacggcctt gattgagtcc
1381 gtcctcatca cccaccagcc cacctgggac gactgtcagc agttgttggg gaccctgctg
1441 accggagaag aaaagcagcg ggtgctccta gaggctagaa aggcagtccg gggcaatgat
1501 ggacgcccca ctcagttgcc taatgaagtc aatgctgctt ttccccttga gcgccccgat
1561 tgggattaca ccactacaga aggtaggaac cacctagtcc tctaccgcca gttgctctta
1621 gcgggtctcc aaaacgcggg caggagcccc accaatttgg ccaaggtaaa agggataacc
1681 cagggaccta atgagtctcc ctcagccttt ttagagagac tcaaggaggc ctatcgcagg
1741 tacactcctt atgaccctga ggacccaggg caagaaacca atgtgtccat gtcattcatc
1801 tggcagtctg ccccggatat cggacgaaag ttagagcggt tagaagattt aaagagcaag
1861 accttaggag acttagtgag ggaagctgaa aagatcttta ataagcgaga aaccccggaa
1921 gaaagagagg aacgtatcag gagagaaata gaggaaaaag aagaacgccg tagggcagag
1981 gatgagcaga gagagagaga aagggaccgc agaagacata gagagatgag caagctcttg
2041 gccactgtag ttattggtca gagacaggat agacaggggg gagagcggag gaggccccaa
2101 cttgataagg accaatgcgc ctactgcaaa gaaaagggac actgggctaa ggactgccca
2161 aagaagccac gagggccccg aggaccgagg ccccagacct ccctcctgac cttaggtgac
2221 tagggaggtc agggtcagga gcccccccct gaacccagga taaccctcaa agtcgggggg
2281 caacccgtca ccttcctggt agatactggg gcccaacact ccgtgctgac ccaaaatcct
2341 ggacccctaa gtgacaagtc tgcctgggtc caaggggcta ctggaggaaa gcggtatcgc
2401 tggaccacgg atcgcaaagt acatctggct accggtaagg tcacccactc tttcctccat
2461 gtaccagact gcccctatcc tctgctagga agagacttgc tgactaaact aaaagcccaa
2521 atccactttg agggatcagg agctcaggtt gtgggaccga tgggacagcc cctgcaagtg
2581 ctgacagtaa acatagaaga tgagtattgg ctacatgata ccaggaaaga gccagatgtt
2641 cctctagggt ccacatggct ttctgatttc cttcaggcct gggcggaaac cgggggcatg
2701 ggactggcag ttcgccaagc tcctctgatc atacctctga aggcaacctc tacccccgtg
2761 tccataaaac aataccccat gtcacaagaa gccagactgg ggatcaagcc ccacatacag
2821 aggctgttgg accagggaat actggtaccc tgccagtccc cctggaacac gcccctgcta
2881 cccgttaaga aaccagggac taatgattat aggcctgtcc aggatctgag agaagtcaac
2941 aagcgggtgg aagacatcca ccccaccgtg cccaaccctt acaacctctt gagcgggctc
3001 ccaccgtccc accagtggta cactgtgctt gatttaaagg atgccttttt ctgcctgaga
3061 ctccacccca ccagtcagcc tctcttcgcc tttgagtgga gagatccaga gatgggaatc
3121 tcaggacaac tgacctggac cagactccca cagggtttca aaaacagtcc caccctgttt
3181 gatgaggcac tgcacagaga cctagcagat ttccggatcc agcacccaga cttgatcctg
3241 ctacagtacg tggatgactt actgctggcc gccacttctg agcaagactg ccaacgaggt
3301 actcgggccc tattacaaac cctagggaac ctcgggtatc gggcctcggc caagaaagcc
3361 caaatttgcc agaaacaggt caagtatctg gggtatctcc taaaagaggg acagagatgg
3421 ctgactgagg ccagaaaaga gactgtgatg gggcagccca ctccgaagac ccctcgacaa
3481 ctaagggagt tcctagggac ggcaggcttc tgtcgcctct ggatccctgg gtttgcagaa
3541 atggcagccc ccttgtaccc tcttaccaaa acggggactc tgtttaattg gggcccagac
3601 cagcaaaagg cctatcaaga aatcaaacag gctcttctaa ctgcccccgc cctgggattg
3661 ccagatttga ctaagccctt tgaactcttt gtcgacgaga agcagggcta cgccaaaggc
3721 gtcctaacgc aaaaactggg accttggcgt cggcctgtgg cctacctgtc caaaaagcta
3781 gacccagtgg cagctgggtg gcccccttgc ctacggatgg tagcagccat tgccgttctg
3841 acaaaaaatg caggcaagct aactatggga cagccgctag tcattctggc cccccatgcg
3901 gtagaagcac tggtcaaaca accccctgac cgttggctat ccaatgcccg catgacccac
3961 tatcaggcaa tgctcctgga tacagaccgg gttcagttcg gaccggtggt ggccctcaac
4021 ccggccaccc tgctccccct accggaaaag gaagcccccc atgactgcct cgagatcttg
4081 gctgagacgc acggaaccag accggacctc acggaccagc ccatcccaga cgctgattac
4141 acttggtaca cagatggaag cagcttccta caagaaggac aacggagagc tggagcagcg
4201 gtgactactg agaccgaggt aatctgggcg agggctctgc cggctggaac atccgcccaa
4261 cgagccgaac tgatagcact cacccaagcc ttaaagatgg cagaaggtaa gaagctaaat
4321 gtttacactg atagccgcta tgccttcgcc acggcccatg tccatggaga aatatatagg
4381 aggcgagggt tgctgacctc agaaggcaga gaaattaaaa acaagaacga gatcttggcc
4441 ttgctaaaag ctctctttct gcccaaacga cttagtataa ttcactgtcc aggacatcaa
4501 aaaggaaaca gtgctgaggc cagaggcaac cgtatggcag atcaagcagc ccgagaggca
4561 gccatgaagg cagttctaga aacctctaca ctcctcatag aggactcaac cccgtatacg
4621 cctccccatt tccattacac cgaaacagat ctcaaaagac tacgggaact gggagccacc
4681 tacaatcaga caaaaggata ttgggtccta caaggcaaac ctgtgatgcc cgatcagtcc
4741 gtgtttgaac tgttagactc cctacacaga ctcacccatc tgagccctca aaagatgaag
4801 gcactcctcg acagagaaga aagcccctac tacatgttaa accgggacag aactatccag
4861 tatgtgactg agacctgcac cgcctgtgcc caagtaaatg ccagcaaagc caaaattggg
4921 gcaggggtgc gagtacgcgg acatcggcca ggcacccatt gggaagttga tttcacggaa
4981 gtaaagccag gactgtatgg gtacaagtac ctcctagtgt ttgtagacac cttctctggc
5041 tgggtagagg cattcccgac caagcgggaa actgccaagg tcgtgtccaa aaagctgtta
5101 gaagacattt ttccgagatt tggaatgccg caggtattgg gatctgataa cgggcctgcc
5161 ttcgcctccc aggtaagtca gtcagtggcc gatttactgg ggatcgattg gaagttacat
5221 tgtgcttata gaccccagag ttcaggacag gtagaaagaa tgaatagaac aattaaggag
5281 actttgacca aattaacgct tgcatctggc actagagact gggtactcct actcccctta
5341 gccctctacc gagcccggaa tactccgggc ccccacggac tgactccgta tgaaattctg
5401 tatggggcac ccccgcccct tgtcaatttt catgatcctg aaatgtcaaa gttaactaat
5461 agtccctctc tccaagctca cttacaggcc ctccaagcag tacaacaaga ggtctggaag
5521 ccgctggccg ctgcttatca ggaccagcta gatcagccag tgataccaca ccccttccgt
5581 gtcggtgacg ccgtgtgggt acgccggcac cagactaaga acttagaacc tcgctggaaa
5641 ggaccctaca ccgtcctgct gacaaccccc accgctctca aagtagacgg catctctgcg
5701 tggatacacg ccgctcacgt aaaggcggcg acaactcctc cggccggaac agcatggaaa
5761 gtccagcgtt ctcaaaaccc cttaaagata agattaaccc gtggggcccc ctgataatta
5821 tggggatctt ggtgagggca ggagcctcag tacaacgtga cagccctcac caggtcttta
5881 atgtcacttg gaaaattacc aacctaatga caggacaaac agctaatgct acctccctcc
5941 tggggacgat gacagacact ttccctaaac tatattttga cttgtgtgat ttagttggag
6001 acaactggga tgacccggaa cccgatattg gagatggttg ccgctctccc gggggaagaa
6061 aaaggacaag actatatgat ttctatgttt gccccggtca tactgtatta acagggtgtg
6121 gagggccgag agagggctac tgtggcaaat ggggatgtga gaccactgga caggcatact
6181 ggaagccatc atcatcatgg gacctaattt cccttaagcg aggaaacact cctaagggtc
6241 agggcccctg ttttgattcc tcagtgggct ccggtagcat ccagggtgcc acaccggggg
6301 gtcgatgcaa ccccctagtc ctagaattca ctgacgcggg taaaagggcc agctgggatg
6361 cccccaaaac atggggacta agactgtatc gatccactgg ggccgacccg gtgaccctgt
6421 tctctctgac ccgccaggtc ctcaatgtag ggccccgcgt ccccattggg cctaatcccg
6481 tgatcactga acagctaccc ccctcccaac ccgtgcagat catgctcccc aggactcctc
6541 gtcctcctcc ttcaggcgcg gcctctatgg tgcctggggc tcccccgcct tctcaacaac
6601 ctgggacggg agacaggctg ctaaacctgg tagaaggagc ctacctagcc ctcaacctca
6661 ccagtcccga caaaacccaa gagtgctggc tgtgtctagt atcgggaccc ccctactacg
6721 aaggggtggc cgtcctaggt acttactcca accatacctc tgccccggct aactgctccg
6781 tgacctccca acacaagctg accctgtccg aagtgaccgg gcagggactc tgcataggag
6841 cagttcccaa aacccatcag gccctgtgta ataccaccca gaagacgagc gacgggtcct
6901 actatttggc ctctcccgcc gggaccattt gggcttgcag caccgggctc actccctgtc
6961 tatctactac tgtgcttaac ttaaccactg attactgtgt cctggttgaa ctctggccaa
7021 aggtaaccta ccactcccct aattatgttt atggccagtt tgaaaagaaa actaaatata
7081 aaagagagcc ggtgtcatta actctggccc tgctgttggg aggacttact atgggcggca
7141 tagctgcagg agttggaaca gggactacag ccctagtggc caccaaacaa ttcgagcagc
7201 tccaggcagc catacataca gaccttgggg ccttagaaaa atcagtcagt gccctagaaa
7261 agtctctgac ctcgttgtct gaggtggtcc tacagaaccg gaggggatta gatctactgt
7321 tcctaaaaga aggaggatta tgtgctgccc taaaagaaga atgctgtttt tacgcggacc
7381 acactggcgt agtaagagat agcatggcaa agctaagaga aaggttaaac cagagacaaa
7441 aattgttcga atcaggacaa gggtggtttg agggactgtt taacaggtcc ccatggttca
7501 cgaccctgat atccaccatt atgggccctc tgatagtact tttattaatc ctactcttcg
7561 gaccctgtat tctcaaccgc ttggtccagt ttgtaaaaga cagaatttcg gtagtgcagg
7621 ccctggttct gacccaacag tatcaccaac tcaaatcaat agatccagaa gaagtggaat
7681 cacgtgaata aaagatttta ttcagtttcc agaaagaggg gggaatgaaa gaccccacca
7741 taaggcttag cacgctagct acagtaacgc cattttgcaa ggcatggaaa agtaccagag
7801 ctgagttctc aaaagttaca aggaagttta attaaagaat aaggctgaat aacactggga
7861 caggggccaa acaggatatc tgtagtcagg cacctgggcc ccggctcagg gccaagaaca
7921 gatggtcctc agataaagcg aaactaacaa cagtttctgg aaagtcccac ctcagtttca
7981 agttccccaa aagaccggga aataccccaa gccttattta aactaaccaa tcagctcgct
8041 tctcgcttct gtacccgcgc tttttgctcc ccagtcctag ccctataaaa aaggggtaag
8101 aactccacac tcggcgcgcc agtcatccga tagactgagt cgcccgggta cccgtgttcc
8161 caataaagcc ttttgctgtt tgcaa

or go to


Senior Member
LOCUS NC_007815 8185 bp ss-RNA linear VRL 08-DEC-2008
DEFINITION Xenotropic MuLV-related virus VP62, complete genome.

SOURCE Xenotropic MuLV-related virus VP62
ORGANISM Xenotropic MuLV-related virus VP62
Viruses; Retro-transcribing viruses; Retroviridae;
Orthoretrovirinae; Gammaretrovirus.
REFERENCE 1 (bases 1 to 8185)

AUTHORS Urisman,A., Molinaro,R.J., Fischer,N., Plummer,S.J., Casey,G.,
Klein,E.A., Malathi,K., Magi-Galluzzi,C., Tubbs,R.R., Ganem,D.,
Silverman,R.H. and DeRisi,J.L.

TITLE Identification of a novel Gammaretrovirus in prostate tumors of
patients homozygous for R462Q RNASEL variant



gene 613..2223
CDS 613..2223
/product="putative gag polyprotein"

misc_feature 5479..5487
/note="splice acceptor"
gene 5754..7691
CDS 5754..7691
/product="putative envelope polyprotein"
LTR 7726..8184
/note="3' LTR"
repeat_region 7726..8115
protein_bind 7915..7929
/note="androgen response element (ARE)"
CAAT_signal 8027..8031
TATA_signal 8084..8090
repeat_region 8116..8184
polyA_signal 8162..8167
polyA_site 8185
1 gcgccagtca tccgatagac tgagtcgccc gggtacccgt gttcccaata aagccttttg
61 ctgtttgcat ccgaagcgtg gcctcgctgt tccttgggag ggtctcctca gagtgattga
121 ctacccagct cgggggtctt tcatttgggg gctcgtccgg gattcggaga cccccgccca
181 gggaccaccg acccaccgtc gggaggtaag ccggccggcg atcgttttgt ctttgtctct
241 gtctttgtgc gtgtgtgtgt gtgccggcat ctaatcctcg cgcctgcgtc tgaatctgta
301 ctagttagct aactagatct gtatctggcg gttccgcgga agaactgacg agttcgtatt
361 cccggccgca gccctgggag acgtcccagc ggcctcgggg gcccgttttg tggcccattc
421 tgtatcagtt aacctacccg agtcggactt tttggagtgg ctttgttggg ggacgagaga
481 cagagacact tcccgccccc gtctgaattt ttgctttcgg ttttacgccg aaaccgcgcc
541 gcgcgtctga tttgttttgt tgttcttctg ttcttcgtta gttttcttct gtctttaagt
601 gttctcgaga tcatgggaca gaccgtaact acccctctga gtctaacctt gcagcactgg
661 ggagatgtcc agcgcattgc atccaaccag tctgtggatg tcaagaagag gcgctgggtt
721 accttctgtt ccgccgaatg gccaactttc aatgtaggat ggcctcagga tggtactttt
781 aatttaggtg ttatctctca ggtcaagtct agagtgtttt gtcctggtcc ccacggacac
841 ccggatcagg tcccatatat cgtcacctgg gaggcacttg cctatgaccc ccctccgtgg
901 gtcaaaccgt ttgtctctcc taaaccccct cctttaccga cagctcccgt cctcccgccc
961 ggtccttctg cgcaacctcc gtcccgatct gccctttacc ctgcccttac cccctctata
1021 aagtccaaac ctcctaagcc ccaggttctc cctgatagcg gcggacctct cattgacctt
1081 ctcacagagg atcccccgcc gtacggagca caaccttcct cctctgccag ggagaacaat
1141 gaagaagagg cggccaccac ctccgaggtt tccccccctt ctcccatggt gtctcgactg
1201 cggggaagga gagaccctcc cgcagcggac tccaccacct cccaggcatt cccactccgc
1261 atggggggag atggccagct tcagtactgg ccgttttcct cctctgattt atataattgg
1321 aaaaataata acccttcctt ttctgaagat ccaggtaaat tgacggcctt gattgagtcc
1381 gtcctcatca cccaccagcc cacctgggac gactgtcagc agttgttggg gaccctgctg
1441 accggagaag aaaagcagcg ggtgctccta gaggctagaa aggcagtccg gggcaatgat
1501 ggacgcccca ctcagttgcc taatgaagtc aatgctgctt ttccccttga gcgccccgat
1561 tgggattaca ccactacaga aggtaggaac cacctagtcc tctaccgcca gttgctctta
1621 gcgggtctcc aaaacgcggg caggagcccc accaatttgg ccaaggtaaa agggataacc
1681 cagggaccta atgagtctcc ctcagccttt ttagagagac tcaaggaggc ctatcgcagg
1741 tacactcctt atgaccctga ggacccaggg caagaaacca atgtgtccat gtcattcatc
1801 tggcagtctg ccccggatat cggacgaaag ttagagcggt tagaagattt aaagagcaag
1861 accttaggag acttagtgag ggaagctgaa aagatcttta ataagcgaga aaccccggaa
1921 gaaagagagg aacgtatcag gagagaaata gaggaaaaag aagaacgccg tagggcagag
1981 gatgagcaga gagagagaga aagggaccgc agaagacata gagagatgag caagctcttg
2041 gccactgtag ttattggtca gagacaggat agacaggggg gagagcggag gaggccccaa
2101 cttgataagg accaatgcgc ctactgcaaa gaaaagggac actgggctaa ggactgccca
2161 aagaagccac gagggccccg aggaccgagg ccccagacct ccctcctgac cttaggtgac
2221 tagggaggtc agggtcagga gcccccccct gaacccagga taaccctcaa agtcgggggg
2281 caacccgtca ccttcctggt agatactggg gcccaacact ccgtgctgac ccaaaatcct
2341 ggacccctaa gtgacaagtc tgcctgggtc caaggggcta ctggaggaaa gcggtatcgc
2401 tggaccacgg atcgcaaagt acatctggct accggtaagg tcacccactc tttcctccat
2461 gtaccagact gcccctatcc tctgctagga agagacttgc tgactaaact aaaagcccaa
2521 atccactttg agggatcagg agctcaggtt gtgggaccga tgggacagcc cctgcaagtg
2581 ctgacagtaa acatagaaga tgagtattgg ctacatgata ccaggaaaga gccagatgtt
2641 cctctagggt ccacatggct ttctgatttc cttcaggcct gggcggaaac cgggggcatg
2701 ggactggcag ttcgccaagc tcctctgatc atacctctga aggcaacctc tacccccgtg
2761 tccataaaac aataccccat gtcacaagaa gccagactgg ggatcaagcc ccacatacag
2821 aggctgttgg accagggaat actggtaccc tgccagtccc cctggaacac gcccctgcta
2881 cccgttaaga aaccagggac taatgattat aggcctgtcc aggatctgag agaagtcaac
2941 aagcgggtgg aagacatcca ccccaccgtg cccaaccctt acaacctctt gagcgggctc
3001 ccaccgtccc accagtggta cactgtgctt gatttaaagg atgccttttt ctgcctgaga
3061 ctccacccca ccagtcagcc tctcttcgcc tttgagtgga gagatccaga gatgggaatc
3121 tcaggacaac tgacctggac cagactccca cagggtttca aaaacagtcc caccctgttt
3181 gatgaggcac tgcacagaga cctagcagat ttccggatcc agcacccaga cttgatcctg
3241 ctacagtacg tggatgactt actgctggcc gccacttctg agcaagactg ccaacgaggt
3301 actcgggccc tattacaaac cctagggaac ctcgggtatc gggcctcggc caagaaagcc
3361 caaatttgcc agaaacaggt caagtatctg gggtatctcc taaaagaggg acagagatgg
3421 ctgactgagg ccagaaaaga gactgtgatg gggcagccca ctccgaagac ccctcgacaa
3481 ctaagggagt tcctagggac ggcaggcttc tgtcgcctct ggatccctgg gtttgcagaa
3541 atggcagccc ccttgtaccc tcttaccaaa acggggactc tgtttaattg gggcccagac
3601 cagcaaaagg cctatcaaga aatcaaacag gctcttctaa ctgcccccgc cctgggattg
3661 ccagatttga ctaagccctt tgaactcttt gtcgacgaga agcagggcta cgccaaaggc
3721 gtcctaacgc aaaaactggg accttggcgt cggcctgtgg cctacctgtc caaaaagcta
3781 gacccagtgg cagctgggtg gcccccttgc ctacggatgg tagcagccat tgccgttctg
3841 acaaaaaatg caggcaagct aactatggga cagccgctag tcattctggc cccccatgcg
3901 gtagaagcac tggtcaaaca accccctgac cgttggctat ccaatgcccg catgacccac
3961 tatcaggcaa tgctcctgga tacagaccgg gttcagttcg gaccggtggt ggccctcaac
4021 ccggccaccc tgctccccct accggaaaag gaagcccccc atgactgcct cgagatcttg
4081 gctgagacgc acggaaccag accggacctc acggaccagc ccatcccaga cgctgattac
4141 acttggtaca cagatggaag cagcttccta caagaaggac aacggagagc tggagcagcg
4201 gtgactactg agaccgaggt aatctgggcg agggctctgc cggctggaac atccgcccaa
4261 cgagccgaac tgatagcact cacccaagcc ttaaagatgg cagaaggtaa gaagctaaat
4321 gtttacactg atagccgcta tgccttcgcc acggcccatg tccatggaga aatatatagg
4381 aggcgagggt tgctgacctc agaaggcaga gaaattaaaa acaagaacga gatcttggcc
4441 ttgctaaaag ctctctttct gcccaaacga cttagtataa ttcactgtcc aggacatcaa
4501 aaaggaaaca gtgctgaggc cagaggcaac cgtatggcag atcaagcagc ccgagaggca
4561 gccatgaagg cagttctaga aacctctaca ctcctcatag aggactcaac cccgtatacg
4621 cctccccatt tccattacac cgaaacagat ctcaaaagac tacgggaact gggagccacc
4681 tacaatcaga caaaaggata ttgggtccta caaggcaaac ctgtgatgcc cgatcagtcc
4741 gtgtttgaac tgttagactc cctacacaga ctcacccatc tgagccctca aaagatgaag
4801 gcactcctcg acagagaaga aagcccctac tacatgttaa accgggacag aactatccag
4861 tatgtgactg agacctgcac cgcctgtgcc caagtaaatg ccagcaaagc caaaattggg
4921 gcaggggtgc gagtacgcgg acatcggcca ggcacccatt gggaagttga tttcacggaa
4981 gtaaagccag gactgtatgg gtacaagtac ctcctagtgt ttgtagacac cttctctggc
5041 tgggtagagg cattcccgac caagcgggaa actgccaagg tcgtgtccaa aaagctgtta
5101 gaagacattt ttccgagatt tggaatgccg caggtattgg gatctgataa cgggcctgcc
5161 ttcgcctccc aggtaagtca gtcagtggcc gatttactgg ggatcgattg gaagttacat
5221 tgtgcttata gaccccagag ttcaggacag gtagaaagaa tgaatagaac aattaaggag
5281 actttgacca aattaacgct tgcatctggc actagagact gggtactcct actcccctta
5341 gccctctacc gagcccggaa tactccgggc ccccacggac tgactccgta tgaaattctg
5401 tatggggcac ccccgcccct tgtcaatttt catgatcctg aaatgtcaaa gttaactaat
5461 agtccctctc tccaagctca cttacaggcc ctccaagcag tacaacaaga ggtctggaag
5521 ccgctggccg ctgcttatca ggaccagcta gatcagccag tgataccaca ccccttccgt
5581 gtcggtgacg ccgtgtgggt acgccggcac cagactaaga acttagaacc tcgctggaaa
5641 ggaccctaca ccgtcctgct gacaaccccc accgctctca aagtagacgg catctctgcg
5701 tggatacacg ccgctcacgt aaaggcggcg acaactcctc cggccggaac agcatggaaa
5761 gtccagcgtt ctcaaaaccc cttaaagata agattaaccc gtggggcccc ctgataatta
5821 tggggatctt ggtgagggca ggagcctcag tacaacgtga cagccctcac caggtcttta
5881 atgtcacttg gaaaattacc aacctaatga caggacaaac agctaatgct acctccctcc
5941 tggggacgat gacagacact ttccctaaac tatattttga cttgtgtgat ttagttggag
6001 acaactggga tgacccggaa cccgatattg gagatggttg ccgctctccc gggggaagaa
6061 aaaggacaag actatatgat ttctatgttt gccccggtca tactgtatta acagggtgtg
6121 gagggccgag agagggctac tgtggcaaat ggggatgtga gaccactgga caggcatact
6181 ggaagccatc atcatcatgg gacctaattt cccttaagcg aggaaacact cctaagggtc
6241 agggcccctg ttttgattcc tcagtgggct ccggtagcat ccagggtgcc acaccggggg
6301 gtcgatgcaa ccccctagtc ctagaattca ctgacgcggg taaaagggcc agctgggatg
6361 cccccaaaac atggggacta agactgtatc gatccactgg ggccgacccg gtgaccctgt
6421 tctctctgac ccgccaggtc ctcaatgtag ggccccgcgt ccccattggg cctaatcccg
6481 tgatcactga acagctaccc ccctcccaac ccgtgcagat catgctcccc aggactcctc
6541 gtcctcctcc ttcaggcgcg gcctctatgg tgcctggggc tcccccgcct tctcaacaac
6601 ctgggacggg agacaggctg ctaaacctgg tagaaggagc ctacctagcc ctcaacctca
6661 ccagtcccga caaaacccaa gagtgctggc tgtgtctagt atcgggaccc ccctactacg
6721 aaggggtggc cgtcctaggt acttactcca accatacctc tgccccggct aactgctccg
6781 tgacctccca acacaagctg accctgtccg aagtgaccgg gcagggactc tgcataggag
6841 cagttcccaa aacccatcag gccctgtgta ataccaccca gaagacgagc gacgggtcct
6901 actatttggc ctctcccgcc gggaccattt gggcttgcag caccgggctc actccctgtc
6961 tatctactac tgtgcttaac ttaaccactg attactgtgt cctggttgaa ctctggccaa
7021 aggtaaccta ccactcccct aattatgttt atggccagtt tgaaaagaaa actaaatata
7081 aaagagagcc ggtgtcatta actctggccc tgctgttggg aggacttact atgggcggca
7141 tagctgcagg agttggaaca gggactacag ccctagtggc caccaaacaa ttcgagcagc
7201 tccaggcagc catacataca gaccttgggg ccttagaaaa atcagtcagt gccctagaaa
7261 agtctctgac ctcgttgtct gaggtggtcc tacagaaccg gaggggatta gatctactgt
7321 tcctaaaaga aggaggatta tgtgctgccc taaaagaaga atgctgtttt tacgcggacc
7381 acactggcgt agtaagagat agcatggcaa agctaagaga aaggttaaac cagagacaaa
7441 aattgttcga atcaggacaa gggtggtttg agggactgtt taacaggtcc ccatggttca
7501 cgaccctgat atccaccatt atgggccctc tgatagtact tttattaatc ctactcttcg
7561 gaccctgtat tctcaaccgc ttggtccagt ttgtaaaaga cagaatttcg gtagtgcagg
7621 ccctggttct gacccaacag tatcaccaac tcaaatcaat agatccagaa gaagtggaat
7681 cacgtgaata aaagatttta ttcagtttcc agaaagaggg gggaatgaaa gaccccacca
7741 taaggcttag cacgctagct acagtaacgc cattttgcaa ggcatggaaa agtaccagag
7801 ctgagttctc aaaagttaca aggaagttta attaaagaat aaggctgaat aacactggga
7861 caggggccaa acaggatatc tgtagtcagg cacctgggcc ccggctcagg gccaagaaca
7921 gatggtcctc agataaagcg aaactaacaa cagtttctgg aaagtcccac ctcagtttca
7981 agttccccaa aagaccggga aataccccaa gccttattta aactaaccaa tcagctcgct
8041 tctcgcttct gtacccgcgc tttttgctcc ccagtcctag ccctataaaa aaggggtaag
8101 aactccacac tcggcgcgcc agtcatccga tagactgagt cgcccgggta cccgtgttcc
8161 caataaagcc ttttgctgtt tgcaa

or go to





Yeah, makes your eyeballs cross doesn't it!? (grins)

I'm no geneticist but I can tell you what I know about what's written here. (ain't much (Big grings))

If you look at the part that's labeled with numbers; Starts with 1 and ends with 8161 That's all the "nucleotides" that make up the virus. Each one is a protein. Different sets of proteins will create different things. Like a little "capsid" or envelope around the virus. Or it might be a sequences that is used to fool the immune system from trying to eat it.

In HIV the "cg" set of proteins only shows up in the genome 0.88% of the time. Because there aren't very many "cg" sets it get's by the immune system which looks for "cg" sets when it looks for things to destroy. In XMRV the "cg" sets are only 3.75% so they fool the immune system some of the time so there must be 'something' else that allows it to hide out or not to be gobbled up by our immune cells. Still the 3.75% is only about half of what you would expect to show up on a genome this long.

Warning Speculation Ahead (grins) It's ability to penetrate the bodies core systems including digestive (GI), reproductive (but not uterine, which is interesting) and immune systems (lymph glands) means that it either encodes a protein sequence that the body recognizes as needed (not likely) or it turns off the bodies ability to recognizes it as a threat. (most likely, see Gerwyns post on the why we don't get colds thread)

This is all so cool!


Yeah, makes your eyeballs cross doesn't it!? (grins)

I'm no geneticist but I can tell you what I know about what's written here. (ain't much (Big grings))

If you look at the part that's labeled with numbers; Starts with 1 and ends with 8161 That's all the "nucleotides" that make up the virus. Each one is a protein. Different sets of proteins will create different things. Like a little "capsid" or envelope around the virus. Or it might be a sequences that is used to fool the immune system from trying to eat it.

In HIV the "cg" set of proteins only shows up in the genome 0.88% of the time. Because there aren't very many "cg" sets it get's by the immune system which looks for "cg" sets when it looks for things to destroy. In XMRV the "cg" sets are only 3.75% so they fool the immune system some of the time so there must be 'something' else that allows it to hide out or not to be gobbled up by our immune cells. Still the 3.75% is only about half of what you would expect to show up on a genome this long.

Warning Speculation Ahead (grins) It's ability to penetrate the bodies core systems including digestive (GI), reproductive (but not uterine, which is interesting) and immune systems (lymph glands) means that it either encodes a protein sequence that the body recognizes as needed (not likely) or it turns off the bodies ability to recognizes it as a threat. (most likely, see Gerwyns post on the why we don't get colds thread)

This is all so cool!
Thanks george my computer is on the blink so I may go silent for a while---I will be back!


Hi george my speeds are down to dial up--can you find the missing sequences in the inactivated clone in the last london study Bones in it(laughs)


UK sequences used for the PCR

Genomic (g)DNA was prepared from PBMC from SGUL patients and controls using the QIAamp DNA mini kit (Qiagen) and amplified using the RepliG Ultrafast Mini Kit (Qiagen), which provides highly uniform amplification of all sequences, with negligible sequence bias. The concentrations after amplification ranged from 108 - 586 ng/Ml. Initially, 48 CFS patient gDNA samples were screened by single-round PCR for gag and env genes, as well as GAPDH, as outlined by Lombardi et al. [8] (Table 1).

This PCR was performed in a 50 Ml reaction volume consisting of 25 Ml
amplitaq gold PCR mastermix and a final DNA concentration of 2-5 ng/Ml. Cycling was modified as appropriate to our mastermix; 95 oC for 5 min, (95 oC for 30 sec, 57 oC for 30 sec, and 72 oC for 60 sec) for 45 cycles, hold at 72 oC for 7 min, store at 4 oC. Products were visualized on 3% agarose gels by ethidium bromide staining.

As we did not amplify any products using this PCR, we developed two more sensitive real-time qPCR assays which targeted 2 regions of the env gene, beginning at nt 6173 and 6682, respectively (Table 1).

These were used to screen samples of gDNA (prepared from PBMC) or cDNA (prepared from total RNA extracted using the Paxgene system from Preanalytix, UK) from CFS and normal blood donors. In total, 136 CFS gDNA and 140 CFS cDNA samples and 95 control gDNA and 141 control cDNA samples were analysed, such that all 142 CFS patients and 157 blood donors were screened for XMRV using these assays in either genomic DNA, cDNA or both.

GAPDH was also amplified as a control using a commercial primer and probe set
(Hs_99999905_m1 from Applied Biosystems). Real-time qPCR reactions were
performed in 10 Ml total volume, consisting of 5 Ml PCR mastermix, 0.5 Ml (20x) Taqman primers/probe mix, 4.5 Ml sample (for gDNA, 1 Ml gDNA (100-590ng) and 3.5 Ml DEPC-treated water (Ambion); for cDNA, 4.5 Ml cDNA). Cycling times and temperatures were as follows. Initial denaturation occurred for 10 min at 95 C, followed by 40 cycles of denaturation at 95 C for 15 sec and combined primer annealing/extension at 60 C for 1 min. Data were displayed using SDS 1.3.1 software (ABI).

Dr. Yes

Shame on You
Gerwyn, you're not actually going to try and manually compare the sequences to see if the UK inactivated clones were missing the regions to which, as reported in the SF retrovirology conference, human antibodies were found -- are you?!?

If so, I will take my hat off to you. :Green hat:


Gerwyn, you're not actually going to try and manually compare the sequences to see if the UK inactivated clones were missing the regions to which, as reported in the SF retrovirology conference, human antibodies were found -- are you?!?

If so, I will take my hat off to you. :Green hat:
I,ve had a quick look but it will take a day or two!i,m particulary interested on the splicing areas the integrase enzyme and the sites of insertion re NO synthase TGFbeta and finally its potential to upregulate the beta interferon gene.I am interested in this unique env sequence.Retoviruses have evolved into gene switches so this bug could do a lot more than appears possible at first glance


Hi Dr Yes,
I realise how garbled my last post was.There is a gene encoding for inducible nitric oxide synthase called Nos20.if stimulated it produces high enough levels of nitric oxide to directly and irreperably damage mitochondria deplete glutathione and other immune nastys.Hyperstimulation of this gene is thought to exist in Hep C infections.Leaving this gene switched on or its inhibitor switched of could cause the immune cascade postulated in ME.Obviously speculation but endos have been known to do similar things with other genes so I,m having a look!


Senior Member
Czech Republic, EU
I am not a biologist but I have some software that is able to do some bioinformatics' computation, so just out of curiosity I compared the first 14 letters "from the virus": GCGCCAGTCATCCG with the human genome, here is the result:

(Chromosome11, 1), (128210571, 128210584)

Actually I could find the longest such subsequence "from the virus" which is identical to a sequence in human genome or I can list them all with some limit on their length. But I absolutely have no clue what it could be useful for ;) :)


I am not a biologist but I have some software that is able to do some bioinformatics' computation, so just out of curiosity I compared the first 14 letters "from the virus": GCGCCAGTCATCCG with the human genome, here is the result:

(Chromosome11, 1), (128210571, 128210584)

Actually I could find the longest such subsequence "from the virus" which is identical to a sequence in human genome or I can list them all with some limit on their length. But I absolutely have no clue what it could be useful for ;) :)
Oh yes please that would save me hours!i,m looking for possible insertion sites and hence ability to upregulate or down regulate genes and or to induce polymorphism of the gene which in the end produces nitric oxide


Plays With Voodoo Dollies
Hi Dr Yes,
I realise how garbled my last post was.There is a gene encoding for inducible nitric oxide synthase called Nos20.if stimulated it produces high enough levels of nitric oxide to directly and irreperably damage mitochondria deplete glutathione and other immune nastys.Hyperstimulation of this gene is thought to exist in Hep C infections.Leaving this gene switched on or its inhibitor switched of could cause the immune cascade postulated in ME.Obviously speculation but endos have been known to do similar things with other genes so I,m having a look!
Would that be a good or bad thing in terms of treatment/cure?


Senior Member
Czech Republic, EU
Today I was just able to find all subsequences of length 20 from the virus in the human genome. These are as follows:

From XMRV:
GTCTTTGTGCGTGTGTGTGT: ("Chromosome15", 1), (59912998, 59913017)

GATGAGCAGAGAGAGAGAGA: ("Chromosome1", -1), (225509884, 225509903)
("Chromosome2", -1), (77761826, 77761845)
("Chromosome22", 1), (17936465, 17936484)

CCAGGAAAGAGCCAGATGTT: ("Chromosome1", -1), (191208767, 191208786)

CTAAGGGAGTTCCTAGGGAC: ("Chromosome11", 1), (22297057, 22297076)

AGAAGGCAGAGAAATTAAAA: ("Chromosome17", -1), (68495483, 68495502)

GGAAGCCATCATCATCATGG: ("Chromosome22", -1), (15359028, 15359047)

AGGGCCCCTGTTTTGATTCC: ("Chromosome1", -1), (153005828, 153005847)