1. Patients launch $1.27 million crowdfunding campaign for ME/CFS gut microbiome study.
    Check out the website, Facebook and Twitter. Join in donate and spread the word!
Dr. Kerr, I presume?
Clark Ellis brings us a rare interview with British researcher Dr. Jonathan Kerr who is now living in Colombia.
Discuss the article on the Forums.

XMRV and the Immune response

Discussion in 'XMRV Testing, Treatment and Transmission' started by Djembe, Nov 4, 2009.

  1. lebowski

    lebowski

    Messages:
    84
    Likes:
    1
    hi cold taste ,

    i read ur last post , i had the same overreacting body thing but much weaker than urs , anyway i didnt do anything about it cause it didnt happen very often .. than i began to take mirtazapine for my sleep problem , 15 mg before sleep (half of the antidepressant dose) .. it is a miracle pill for sleep for me and i dont live that overexciting body symptoms anymore like having shortness of breath , sweatin all over while talking to someone .. i dont know how it works or if it can work for anyone else and dont think it is a real cure but i think it can be an option to try anyway , i hope it helps ..
     
  2. George

    George Guest

    Sequencing XMRV

    I found this on the web and thought it might be of interest to the discussion here.
    Simple genome analysis with Arc: In which I examine the XMRV genome and discover little of interest

    I decided to examine the genome of the retrovirus XMRV to see what I could learn. This virus, with the absurd name Xenotropic Murine leukemia virus-Related Virus, was found a few years ago in many cases of prostate cancer and very recently found in many people suffering from chronic fatigue syndrome (more, more). If these studies turn out to be true, it would be quite remarkable that an obscure new retrovirus causes such differing diseases.

    My goal was to take the XMRV genome (the sequence of c's, g's, a's, and t's that make up its RNA), and see if the combination "cg" is a lot more rare than you'd expect. This probably seems like a pretty random thing to do, but there's actually a biological reason.

    One way the human immune system detects invaders is by looking for DNA containing a cytosine followed by a guanine (which is called a CpG dinucleotide). In mammals, most CpG dinucleotides are methylated (specially tagged), so any CpG that shows up is a sign of something invading. My hypothesis was that XMRV might have a very low number of CpG dinucleotides, helping it avoid the immune system and contributing to its ability to cause disease.

    Conveniently, the genome of XMRV has been sequenced and can be downloaded, consisting of 8185 bases:

    1 gcgccagtca tccgatagac tgagtcgccc gggtacccgt gttcccaata aagccttttg
    61 ctgtttgcat ccgaagcgtg gcctcgctgt tccttgggag ggtctcctca gagtgattga
    ...

    It would be a simple matter to use Python to count the number of CG pairs in the genome, but I figured using the Arc language would be more interesting.

    The first step is to write a function to parse out the DNA sequence from the genome file; this consists of the lines between ORIGIN and //, with the spaces and numbers removed.

    (def skip-to-origin (infile)
    (let line (readline infile)
    (if (is 'eof line) line ;quit on eof
    (litmatch "ORIGIN" line) line ;quit on ORIGIN
    (skip-to-origin infile)))) ; recurse

    ; Reads the data from one line
    ; Returns nil on EOF or // line
    (def read-data-line (infile)
    (let line (readline infile)
    (if (is 'eof line) nil
    (litmatch "//" line) nil
    (keep [in _ #\c #\g #\a #\t] line))))

    ; Read the sequence data from ORIGIN to //
    ; Returns a single string
    (def readseq (infile)
    (skip-to-origin infile)
    (string (drain (read-data-line infile))))

    This code simply uses skip-to-origin to read up to the ORIGIN line, and then read-data-line to read the cgat data from each following line.

    The next step is a histogram function to count the number of times each nucleotide occurs into a table. (Edit: I've shortened my original code with some advice from arclanguage.org.)

    ((def hist (seq)
    (counts (coerce seq 'cons)))

    After downloading the genome as "xmrv", I can load the sequence into seq and generate the histogram:

    arc> (= seq (w/infile inf "xmrv" (readseq inf)))
    "gcgccagtcatccgatagactgagtcgcccgggtacccgtgt ...etc"
    arc> (len seq)
    8185
    arc>(hist seq)
    #hash((#\t . 1732) (#\g . 2057) (#\a . 2078) (#\c . 2318))

    The sequence is 8185 nucleotides long as expected, with 1732 T's, 2057 G's, 2078 A's, and 2318 C's. To count the number of times each pair of nucleotides occurs, I made a more general function that will handle pairs or any other sequence of n nucleotides:

    (def histn (seq n)
    (w/table h
    (for i 0 (- (len seq) n)
    (++ (h (cut seq i (+ i n)) 0)))
    h))

    Since I got tired of looking at raw hash tables, I made a short function to format the output as well as generating percentages.

    (def prettyhist (h)
    (let count (reduce + (vals h))
    (let sorted (sort (fn ((k1 v1) (k2 v2)) (> v1 v2))
    (accum addit (each elt h (addit elt))))
    (each (k v) sorted
    (prn k ": " v " (" (num (* (/ v count) 100.) 2) "%)")))))

    Running these functions:

    arc> (prettyhist (histn seq 2))
    cc: 862 (10.53%)
    gg: 639 (7.81%)
    ag: 616 (7.53%)
    ct: 612 (7.48%)
    aa: 588 (7.18%)
    ga: 585 (7.15%)
    ca: 537 (6.56%)
    ac: 529 (6.46%)
    tg: 494 (6.04%)
    tc: 469 (5.73%)
    gc: 458 (5.6%)
    tt: 401 (4.9%)
    gt: 375 (4.58%)
    ta: 368 (4.5%)
    at: 344 (4.2%)
    cg: 307 (3.75%)

    This shows that CG is the most uncommon combination, but not super-low. How does this compare to the frequence if the C/G/A/T frequency was the same, but they were ordered randomly? We can compute this by computing all the possibilities of taking two letters from the original sequence. Instead of actually summing all the combinations, we can just take the cross-product of the original histogram:

    (def cross (h1 h2)
    (let h (table)
    (each (k1 v1) h1
    (each (k2 v2) h2
    (let combo (string k1 k2)
    (if (no (h combo))
    (= (h combo) 0))
    (= (h combo) (+ (h combo) (* v1 v2))))))
    h))

    This gives us the result:

    arc> (prettyhist (cross (hist seq) (hist seq)))
    cc: 5373124 (8.02%)
    ac: 4816804 (7.19%)
    ca: 4816804 (7.19%)
    cg: 4768126 (7.12%)
    gc: 4768126 (7.12%)
    aa: 4318084 (6.45%)
    ag: 4274446 (6.38%)
    ga: 4274446 (6.38%)
    gg: 4231249 (6.32%)
    tc: 4014776 (5.99%)
    ct: 4014776 (5.99%)
    at: 3599096 (5.37%)
    ta: 3599096 (5.37%)
    gt: 3562724 (5.32%)
    tg: 3562724 (5.32%)
    tt: 2999824 (4.48%)

    This tells us that CG would appear 7.12% of the time if the sequence were randomly shuffled, but instead it appears only 3.75% of the time, so CG shows up about half as often as expected. This is in line with known results for the related MuLV virus, so it seems that there's nothing special about XMRV.

    On the other hand, it's known that the HIV genome has a severely low amount of CpG:

    arc> (prettyhist (histn (w/infile inf "hivbru" (readseq inf)) 2))
    aa: 1096 (11.88%)
    ag: 971 (10.52%)
    ca: 766 (8.3%)
    ga: 762 (8.26%)
    at: 691 (7.49%)
    ta: 665 (7.21%)
    gg: 631 (6.84%)
    tg: 548 (5.94%)
    ac: 530 (5.74%)
    tt: 524 (5.68%)
    gc: 430 (4.66%)
    ct: 428 (4.64%)
    gt: 409 (4.43%)
    cc: 381 (4.13%)
    tc: 315 (3.41%)
    cg: 81 (.88%)

    I also took a look at the H1N1 flu sequences. The influenza genome is on 8 separate strands of RNA, so there are 8 separate sequences to process. (The HA segment is the "H" and the NA segment is the "N" in H1N1.) Many H1N1 sequences can be downloaded. I somewhat arbitrarily picked A/Beijing/02/2009(H1N1) since all 8 strands were sequenced. After saving the strands as flu1, ..., flu8, I ran the histogram on all the strands:

    arc> (for i 1 8 (prn "---" i "---")
    (prettyhist (histn (w/infile inf (string "flu" i) (readseq inf)) 2)))

    On all strands, "cg" was at the bottom of the frequency chart. Especially low-frequency strands are 1 (PB2) at 1.93% CpG, 2 (PB1) at 1.52%, 4 (HA) at 1.57%, and 6 (NA) at 1.77%. Strand 8 (NEP) was highest at 3.09%. So it looks like influenza is pretty low in CpG frequency, but not as low as HIV. (Edit: I've since found a paper that examines CpG in influenza in more detail.)

    To conclude, Arc can be used for simple genome analysis. My original hypothesis that XMRV would have low levels of CpG dinucleotides holds, but not as dramatically as for HIV or H1N1 influenza. Apologies to biologists for my oversimplifications, and apologies to statisticians for my lack of p-values :)
     
  3. Eric Johnson from I&I

    Eric Johnson from I&I Senior Member

    Messages:
    337
    Likes:
    0
    Hat's off to you sir -- you've got some serious skills. I'm pretty sure you're statistically significant with numbers like that. In bio the not-very-stringent alpha of 0.05 is of course traditional.

    As you can see in this codon table,
    http://tigger.uic.edu/classes/phys/phys461/phys450/ANJUM02/codon_table.jpg

    it's possible to make all the codons without cg (note the agx options for arginine). If I didn't err, it's also possible to avoid ending with c and starting with g. I'm not sure you can satisfy both simultaneously, but I think so. If you can, one would wonder -- why any cg at all? Not all the sequences are coding ones, of course, and some have other functions such as binding to proteins. But almost all of XMRV is coding -- for that, see

    http://www.pnas.org/content/104/5/1655/F1.large.jpg
     
  4. Eric Johnson from I&I

    Eric Johnson from I&I Senior Member

    Messages:
    337
    Likes:
    0
    This is probably one of the simplifications for which your disclaimer was intended, so you probably didn't overlook it.

    But to be picky, this null model is imperfect, as you may be aware, because coding DNA has more structure (non-randomness, I mean) than a random shuffle of the same nucleotides. That's true whether or not it is biased away from cg. I'm not sure how /much/ more structure it has.

    The amino acids are not used equally frequently, and for each amino acid the possible codons are not used equally frequently. And of course the stop codons aren't used much.
     
  5. garcia

    garcia Aristocrat Extraordinaire

    Messages:
    936
    Likes:
    104
    London, UK
  6. Sushi

    Sushi Moderator and Senior Member Albuquerque

    Messages:
    7,267
    Likes:
    6,323
    Albuquerque
    Dysautonomia & ME/CFS

    Hi Cold Taste,

    I have similar responses to yours, but never so intense. I have Dysautonomia but not POTS--my body doesn't compensate by raising the BP & heart rate--everything just goes erratic and then plummets down.

    My first "shall I call 911" experiences were also chest pain and panic attack symptoms with no real cause--no emotions--just something triggered it. Diazapam was my friend--the only thing that would damp it down and finally I just learned to keep it with me, take it and wait it out--absolutely no fun! Can't tell you the number of times I lay on the floor by the unlocked front door holding the phone trying not to call 911.

    My tilt was very screwy too, though I didn't have as sophisticated equipment as you had--a tech just manually taking BP continuously. Thought that test would do me in!

    I saw an autonomic specialist who put together a cocktail of meds--all low dose--that actually controlled my worst symptoms. Then I started on my own research to fix things more naturally. I am now doing a lot better after a great deal of experimentation--methylation protocol and a great number of detoxification protocols including Laser Energetic Detox.

    For me, reducing the toxic load, viruses, bacterial infections and heavy metals, has also reduced the stress on the ANS. I am also a biker and can now ride again--but not very long or far.

    But again, my symptoms weren't as extreme as yours. I have had a series of long crash periods followed by recovery periods over the years. I am moving into a recovery period now.

    Very best wishes,
    Sushi
     
  7. srmny

    srmny

    Messages:
    81
    Likes:
    0
    Hi Cold Taste,

    My CFS was triggered by a series of car accidents - I totaled 3 cars in 18 months. Like all of us I can look back and see that I had many other precursors to my illness. The first wreck caused a lot of muscle problems that led to a Fibro DX. The second one I was sitting at the bottom of a hill at a red light and an 18 wheeler lost control in the rain and hit me. My startle response went crazy after that accident and I started having severe sleep problems. I routinely did not sleep for 2-3 days. I just lost the ability. I was tired but wired bad. The third accident I was run off the road and that was it for me. Except to see my doctors, I did not leave my darkened room for years. I was treated by a psychiatrist who tried to knock me out but was not very good at it. Klonapin was the only thing that helped. I lay in bed just barely hanging on. If I brought my head up I would feel faint. My family was rarely allowed in to see me. I just could not handle any stimulation or stress. Once I reached the point I was sleeping for longer than 4 hours a night I stopped feeling like I was going to die. I used to call it "7 days dead" - my life expectancy. I could feel myself dying.

    The main things I would say that helped me were IV's 2-3 times a week. My best friend is a nurse and she would take me to see my CFS doc and we would come home with shopping bags filled with IVs - a vitamin and glutathione mixture. I have the "recipe" if anyone is interested. I also had "provocative" hormone tests for coritsol and growth hormone. The growth hormone was very low but the cortisol was the bottom of normal and so I only got the GH then. Every time I would get the shot I felt even worse than I already felt. They raised the level every 3 months and with the increased dose I would feel like I had been body slammed. It took me years to get even close to blood levels that a normal person would have but after a couple of years I began to sleep more than 4 hours and stopped being awake for days at a time. I had to go off the GH for a year because of my brain tumor and I crashed badly during that year. But once I began the GH again I got better.

    I look at the first few years of my illness as an acute phase and now I am in a chronic phase. It was only a couple of years ago that I learned, the hard way, that this chronic phase is relapsing and remitting and I fluctuate between being housebound and bedbound.

    I wish I could offer some help and some hope to you. I will do all that I can from here to try to get real leadership at the CDC. I will keep writing to Congress and donating to the WPI. I wish I could do more.

    srmny
     
  8. FloraT

    FloraT

    Messages:
    1
    Likes:
    0

    I was informed in July 2010 that the XMRV has not been located in SA by that date. I see your tests were done in Belgium ... Dr J.... ? .... Your symptoms are similar to mine. Have you been tested for Rickettsia or Lyme disease?

    My brain is also like paw paw !! :)

    FloraT
    Jhb, SA
     
  9. August59

    August59 Daughters High School Graduation

    Messages:
    1,480
    Likes:
    407
    Upstate SC, USA
    Seems to have my immune system in overdrive

    About the same time as I became ill I also started having random organ attacks. My testosterone started dropping, a few months later I had the worst vertigo attack that I ever had which resulted in sensoneural hearing loss in my right ear only. An Otoneurologist diagnosed it as an autoimmune disorder! My sleep patterns kept getting worse and worse, meanwhile during this time I had a couple of sleep test about a year a part. First one had obtsructive apnea events that were below normal, I had one central apnea event, but it boiled down to no Stage 3 or 4 sleep. The second one had average obstructive apnea events, no central apnea but again no Stage 3 or 4 sleep. I eventually had another sleep test with the MSLT (Nap test) the next day and the diagnosis was severe narcolepsy which has been determined to be a autoimmune disease. now my thyroid is heading in the wrong direction, but I have no antibodies to the thyroid showing up yet. My feet turn purple if I stand or sit still, but the blood, heart and vascular doctor cannot find any anything abnormal. The only comment was that it must be something autoimmune.
    I had sinus surgery over a year ago and where they cut me around the edge of my nose has healed, but the nerves never grew back, so I have numb nose, and the surgeon said he had never seen that happen to anyone. Lately it has been nothing but hot flashes, sweating, dizziness and pain that is traveling from one joint to another. The pain started in my right shoulder then went to the inside of right elbow (bicep tendon) and now has gone to both my SI joints.
    I tested positive for EBV and HHV6, but I haven't been tested for XMRV yet! So, yes I do feel like it can set off autoimmune conditions. I'm surprised that I haven't gotten the mumps since I have never had them and there was no such thing as a vaccine when I came up!
     
  10. helsbells

    helsbells Senior Member

    Messages:
    297
    Likes:
    8
    UK
    I deffinately have autoimmunity issues - actually feel better with a cold which I rarely get, some stuff I have eg IC is deffo an auto immunity problem
     
  11. Jimk

    Jimk

    Messages:
    90
    Likes:
    5
    Cleveland, Ohio
    We keep talking here as if "CFS" is a unitary syndrome or if the impact is from XMRV alone. Remember that what is "typical," if that word can even be used, is people with a common overlap of symptoms like fatigue, exercise intolerance, sleep problems, etc., but only some have viruses like CMV or HHV6, and some have bacteria like Chlamydia pneumoniae (Cpn) or Borrelia; and some have no obvious pathogen, and some have multiple pathogens, and some have immune overactivity and others have immune underactivity and get every cold that comes by.

    Some of these pathogens, completely apart from XMRV, stimulate their own characteristic reactions: Cpn infects immune cells, steals their ATP thus making them dysfunctional, as well as producing porphyrins that stimulate the Sympathetic nervous system and are neurotoxic; Borrelia dumps a lot of LPS endotoxins which have neurotoxic and immune effects, and so on for each pathogen individually as well as collectively. What a mess!

    And as Cort noted, no one really knows much yet about what effects XMRV has on the multiple systems it seems to infect. And we don't know yet what's the cart and what's the horse, and for some of us it could be different even if both of us are infected with XMRV. Was it immune suppression from Cpn infection that opened the door for XMRV, assuming I test positive... I'm still waiting... Or the other way around? I may never know, but if treating XMRV gets me the rest of the way, I don't care what was first.
     
  12. August59

    August59 Daughters High School Graduation

    Messages:
    1,480
    Likes:
    407
    Upstate SC, USA
    I used to get tonsillitis, colds and sinus infections fairly frequently. I haven't had any of them since I've been sick with CFS. I guess it could be because I don't go out very much anymore, but I used to pick them up from my kids (school).
     
  13. thegodofpleasure

    thegodofpleasure Player in a Greek Tragedy

    Messages:
    138
    Likes:
    50
    Matlock, Derbyshire, Uk
    The WPI's working hypothesis

    Judy Mikovits said at the XMRV workshop Q&A (not word for word)

    http://videocast.nih.gov/summary.asp?live=9582&debug=0
    At about 44mins into the video

    Vincent Racaniello on TWIV 98 (with 1hr 8mins + remaining)

    http://www.twiv.tv/2010/09/12/twiv-98-murine-musings-electric-shirts-and-rabid-pathologists/

    Talks about the existence of Glycogag protein on the surface of the viral envelope and the differences that exist in this Glycogag between XMRV and Polytropic MLV.

    If you look up what Glycogag proteins do in the human body http://en.wikipedia.org/wiki/Glycoprotein you can begin to understand how their presence (as a viral envelope protein) could potentially cause mayhem.

    A simple analogy might be with the irritating effect that a grain of sand has on an oyster, just by being inside its shell. Except that unlike an oyster, we can't wrap the source of irritation (the virus) with the equivalent of a nice smooth protective pearl and so we develop a persistent illness.
     

See more popular forum discussions.

Share This Page