1. Patients launch a $1.27 million crowdfunding campaign for ME/CFS gut microbiome study.
    Check out the website, Facebook and Twitter. Join in donate and spread the word!
Lessons from ME/CFS: Finding Meaning in the Suffering
If you're aware of my previous articles here at Phoenix Rising then it's pretty clear that I don't generally spend my time musing upon the philosophy of the disease. I find it better to spend my time reading research and trying my best to break it down to its core elements and write...
Discuss the article on the Forums.

Help please - need genetic map of XMRV with all the base sequences

Discussion in 'XMRV Research and Replication Studies' started by Gerwyn, Feb 22, 2010.

  1. Alesh

    Alesh Senior Member

    Messages:
    176
    Likes:
    0
    Czech Republic, EU
    I am stupid. And it's clinically proved: My IQ dropped by about 45 points due to ME/CFS, at least as to one clinical psychologist who tested me few years ago. :)
  2. subtr4ct

    subtr4ct Senior Member

    Messages:
    112
    Likes:
    0
    I have a lot of spare cycles on a Linux-based computational server, if that would help out at all.
  3. Gerwyn

    Gerwyn Guest

    you dont come across as at stupid to me quite the reverse thanks for all your help i really appreciate it
  4. Alesh

    Alesh Senior Member

    Messages:
    176
    Likes:
    0
    Czech Republic, EU
    Hi, it was not so much a problem of "computational intensity" but a problem with Internet connectivity. I have better Internet connection at work so I tried to find in the human genome any subsequence of the XMRV of length 30. There are precisely 8156 subsequences of the XMRV of length 30 and none of them matches any part of the human genome. I don't know what the biological interpretation would be but I suspect it indicates that XMRV is a relatively novel virus so that not many parts of it got incorporated in the human genome. I am not a biologist but if I recover I promise that I will become one and I will devote all the rest of my life to debunking all the psychosomatic filth.

    I found out that there are some freeware libraries in R that are suitable to the study of phylogenetic trees. I will look at it, if I have enough energy.
  5. Advocate

    Advocate Senior Member

    Messages:
    506
    Likes:
    14
    U.S.A.
    Hi Alesh,

    Then I especially look forward to your recovery. :D
  6. Gerwyn

    Gerwyn Guest

    Alesh If you are up to it can you let me know the % correspondence of the base sequences of xmrv with the human genome
  7. Samuel

    Samuel Bedbound with NO DOCTOR

    Messages:
    221
    Likes:
    2
    Fuzzy matching

    Alesh,

    I hope that your software or the GNU R libraries are capable of agrep- or other-style fuzzy matching in case there are a few nucleotide differences?

    Samuel
  8. Alesh

    Alesh Senior Member

    Messages:
    176
    Likes:
    0
    Czech Republic, EU
    The sequence of length 29:

    GTAGACACCTTCTCTGGCTGGGTAGAGGC at (Chromosome3, 1), (16786152, 16786180)

    This is one of the longest subsequences, i.e., of length 29. I will look tomorrow if there is any other of this length.
  9. Alesh

    Alesh Senior Member

    Messages:
    176
    Likes:
    0
    Czech Republic, EU
  10. Stuart

    Stuart Senior Member

    Messages:
    136
    Likes:
    6
    Hey George, you are all ahead of me on this, but your speculation here caught my eye, I am not sure we all can't get colds. Plus, what I recall is unlike other virus making loads of copies and spewing them forth, XMRV is happy to take over a cell and spew just viral proteins.

    That got me thinking about a hunch I had reading Devin Starlanyl's book on FM regarding the fascia and ground substance, it makes the cell wall and cell cytoskeleton as well. FM may originate in the fascia from a paper from OHSU, there are about a dozen or so proteins making up these tissues.

    It is likely mitochondrial dysfunction, per Myhill, is a core problem with CFS, the mitos are old and few and therefore function poorly to produce ATP, they seem not to go into Apoptosis properly. So I check on how apoptosis is supposed to function, for some reason a process called blebbing causes the decoupling of the cytoskeleton from the plasma membrane, the cytoskeleton breaks up.

    Soooo... My speculation is that something is inhibiting that process, could it be that the body is taking up 'like' proteins that are not working properly? Your cells have "fibro?" :scared: So actually I prefer your first speculation as fitting my hunch. Or maybe some kind of blebbistatin is produced?

    Okay I am :sleepy: and I have a :headache: time to go :In bed:

    I like you guys are on the case! :thumbsup:
  11. natasa778

    natasa778 Senior Member

    Messages:
    1,326
    Likes:
    1,043
    London UK
    Didn't the French study just published reveal that to be the case? Something to do with SU of its ENV protein turning off crucial bits of host immune system...

    Interesting also that this SU bit acts as a neurotoxin.

See more popular forum discussions.

Share This Page