August 8th, 2016: Understanding and Remembrance Day for Severe Myalgic Encephalomyelitis
Jody Smith joins with other ME voices in honor of Understanding and Remembrance Day for Severe Myalgic Encephalomyelitis.
Discuss the article on the Forums.

Help please - need genetic map of XMRV with all the base sequences

Discussion in 'XMRV Research and Replication Studies' started by Gerwyn, Feb 22, 2010.

  1. Gerwyn

    Gerwyn Guest

    Does anyone have access to the genetic map of XMRV with all the base sequences,any information about its insertase enzyme and any info on insertion sites within the human genome.Any help would be greatly appreciated Thankyou
  2. George

    George Guest

    Need something fetched (grins)

    LOCUS NC_007815 8185 bp ss-RNA linear VRL 08-DEC-2008
    DEFINITION Xenotropic MuLV-related virus VP62, complete genome.

    SOURCE Xenotropic MuLV-related virus VP62
    ORGANISM Xenotropic MuLV-related virus VP62
    Viruses; Retro-transcribing viruses; Retroviridae;
    Orthoretrovirinae; Gammaretrovirus.
    REFERENCE 1 (bases 1 to 8185)

    AUTHORS Urisman,A., Molinaro,R.J., Fischer,N., Plummer,S.J., Casey,G.,
    Klein,E.A., Malathi,K., Magi-Galluzzi,C., Tubbs,R.R., Ganem,D.,
    Silverman,R.H. and DeRisi,J.L.

    TITLE Identification of a novel Gammaretrovirus in prostate tumors of
    patients homozygous for R462Q RNASEL variant



    gene 613..2223
    CDS 613..2223
    /product="putative gag polyprotein"

    misc_feature 5479..5487
    /note="splice acceptor"
    gene 5754..7691
    CDS 5754..7691
    /product="putative envelope polyprotein"
    LTR 7726..8184
    /note="3' LTR"
    repeat_region 7726..8115
    protein_bind 7915..7929
    /note="androgen response element (ARE)"
    CAAT_signal 8027..8031
    TATA_signal 8084..8090
    repeat_region 8116..8184
    polyA_signal 8162..8167
    polyA_site 8185
    1 gcgccagtca tccgatagac tgagtcgccc gggtacccgt gttcccaata aagccttttg
    61 ctgtttgcat ccgaagcgtg gcctcgctgt tccttgggag ggtctcctca gagtgattga
    121 ctacccagct cgggggtctt tcatttgggg gctcgtccgg gattcggaga cccccgccca
    181 gggaccaccg acccaccgtc gggaggtaag ccggccggcg atcgttttgt ctttgtctct
    241 gtctttgtgc gtgtgtgtgt gtgccggcat ctaatcctcg cgcctgcgtc tgaatctgta
    301 ctagttagct aactagatct gtatctggcg gttccgcgga agaactgacg agttcgtatt
    361 cccggccgca gccctgggag acgtcccagc ggcctcgggg gcccgttttg tggcccattc
    421 tgtatcagtt aacctacccg agtcggactt tttggagtgg ctttgttggg ggacgagaga
    481 cagagacact tcccgccccc gtctgaattt ttgctttcgg ttttacgccg aaaccgcgcc
    541 gcgcgtctga tttgttttgt tgttcttctg ttcttcgtta gttttcttct gtctttaagt
    601 gttctcgaga tcatgggaca gaccgtaact acccctctga gtctaacctt gcagcactgg
    661 ggagatgtcc agcgcattgc atccaaccag tctgtggatg tcaagaagag gcgctgggtt
    721 accttctgtt ccgccgaatg gccaactttc aatgtaggat ggcctcagga tggtactttt
    781 aatttaggtg ttatctctca ggtcaagtct agagtgtttt gtcctggtcc ccacggacac
    841 ccggatcagg tcccatatat cgtcacctgg gaggcacttg cctatgaccc ccctccgtgg
    901 gtcaaaccgt ttgtctctcc taaaccccct cctttaccga cagctcccgt cctcccgccc
    961 ggtccttctg cgcaacctcc gtcccgatct gccctttacc ctgcccttac cccctctata
    1021 aagtccaaac ctcctaagcc ccaggttctc cctgatagcg gcggacctct cattgacctt
    1081 ctcacagagg atcccccgcc gtacggagca caaccttcct cctctgccag ggagaacaat
    1141 gaagaagagg cggccaccac ctccgaggtt tccccccctt ctcccatggt gtctcgactg
    1201 cggggaagga gagaccctcc cgcagcggac tccaccacct cccaggcatt cccactccgc
    1261 atggggggag atggccagct tcagtactgg ccgttttcct cctctgattt atataattgg
    1321 aaaaataata acccttcctt ttctgaagat ccaggtaaat tgacggcctt gattgagtcc
    1381 gtcctcatca cccaccagcc cacctgggac gactgtcagc agttgttggg gaccctgctg
    1441 accggagaag aaaagcagcg ggtgctccta gaggctagaa aggcagtccg gggcaatgat
    1501 ggacgcccca ctcagttgcc taatgaagtc aatgctgctt ttccccttga gcgccccgat
    1561 tgggattaca ccactacaga aggtaggaac cacctagtcc tctaccgcca gttgctctta
    1621 gcgggtctcc aaaacgcggg caggagcccc accaatttgg ccaaggtaaa agggataacc
    1681 cagggaccta atgagtctcc ctcagccttt ttagagagac tcaaggaggc ctatcgcagg
    1741 tacactcctt atgaccctga ggacccaggg caagaaacca atgtgtccat gtcattcatc
    1801 tggcagtctg ccccggatat cggacgaaag ttagagcggt tagaagattt aaagagcaag
    1861 accttaggag acttagtgag ggaagctgaa aagatcttta ataagcgaga aaccccggaa
    1921 gaaagagagg aacgtatcag gagagaaata gaggaaaaag aagaacgccg tagggcagag
    1981 gatgagcaga gagagagaga aagggaccgc agaagacata gagagatgag caagctcttg
    2041 gccactgtag ttattggtca gagacaggat agacaggggg gagagcggag gaggccccaa
    2101 cttgataagg accaatgcgc ctactgcaaa gaaaagggac actgggctaa ggactgccca
    2161 aagaagccac gagggccccg aggaccgagg ccccagacct ccctcctgac cttaggtgac
    2221 tagggaggtc agggtcagga gcccccccct gaacccagga taaccctcaa agtcgggggg
    2281 caacccgtca ccttcctggt agatactggg gcccaacact ccgtgctgac ccaaaatcct
    2341 ggacccctaa gtgacaagtc tgcctgggtc caaggggcta ctggaggaaa gcggtatcgc
    2401 tggaccacgg atcgcaaagt acatctggct accggtaagg tcacccactc tttcctccat
    2461 gtaccagact gcccctatcc tctgctagga agagacttgc tgactaaact aaaagcccaa
    2521 atccactttg agggatcagg agctcaggtt gtgggaccga tgggacagcc cctgcaagtg
    2581 ctgacagtaa acatagaaga tgagtattgg ctacatgata ccaggaaaga gccagatgtt
    2641 cctctagggt ccacatggct ttctgatttc cttcaggcct gggcggaaac cgggggcatg
    2701 ggactggcag ttcgccaagc tcctctgatc atacctctga aggcaacctc tacccccgtg
    2761 tccataaaac aataccccat gtcacaagaa gccagactgg ggatcaagcc ccacatacag
    2821 aggctgttgg accagggaat actggtaccc tgccagtccc cctggaacac gcccctgcta
    2881 cccgttaaga aaccagggac taatgattat aggcctgtcc aggatctgag agaagtcaac
    2941 aagcgggtgg aagacatcca ccccaccgtg cccaaccctt acaacctctt gagcgggctc
    3001 ccaccgtccc accagtggta cactgtgctt gatttaaagg atgccttttt ctgcctgaga
    3061 ctccacccca ccagtcagcc tctcttcgcc tttgagtgga gagatccaga gatgggaatc
    3121 tcaggacaac tgacctggac cagactccca cagggtttca aaaacagtcc caccctgttt
    3181 gatgaggcac tgcacagaga cctagcagat ttccggatcc agcacccaga cttgatcctg
    3241 ctacagtacg tggatgactt actgctggcc gccacttctg agcaagactg ccaacgaggt
    3301 actcgggccc tattacaaac cctagggaac ctcgggtatc gggcctcggc caagaaagcc
    3361 caaatttgcc agaaacaggt caagtatctg gggtatctcc taaaagaggg acagagatgg
    3421 ctgactgagg ccagaaaaga gactgtgatg gggcagccca ctccgaagac ccctcgacaa
    3481 ctaagggagt tcctagggac ggcaggcttc tgtcgcctct ggatccctgg gtttgcagaa
    3541 atggcagccc ccttgtaccc tcttaccaaa acggggactc tgtttaattg gggcccagac
    3601 cagcaaaagg cctatcaaga aatcaaacag gctcttctaa ctgcccccgc cctgggattg
    3661 ccagatttga ctaagccctt tgaactcttt gtcgacgaga agcagggcta cgccaaaggc
    3721 gtcctaacgc aaaaactggg accttggcgt cggcctgtgg cctacctgtc caaaaagcta
    3781 gacccagtgg cagctgggtg gcccccttgc ctacggatgg tagcagccat tgccgttctg
    3841 acaaaaaatg caggcaagct aactatggga cagccgctag tcattctggc cccccatgcg
    3901 gtagaagcac tggtcaaaca accccctgac cgttggctat ccaatgcccg catgacccac
    3961 tatcaggcaa tgctcctgga tacagaccgg gttcagttcg gaccggtggt ggccctcaac
    4021 ccggccaccc tgctccccct accggaaaag gaagcccccc atgactgcct cgagatcttg
    4081 gctgagacgc acggaaccag accggacctc acggaccagc ccatcccaga cgctgattac
    4141 acttggtaca cagatggaag cagcttccta caagaaggac aacggagagc tggagcagcg
    4201 gtgactactg agaccgaggt aatctgggcg agggctctgc cggctggaac atccgcccaa
    4261 cgagccgaac tgatagcact cacccaagcc ttaaagatgg cagaaggtaa gaagctaaat
    4321 gtttacactg atagccgcta tgccttcgcc acggcccatg tccatggaga aatatatagg
    4381 aggcgagggt tgctgacctc agaaggcaga gaaattaaaa acaagaacga gatcttggcc
    4441 ttgctaaaag ctctctttct gcccaaacga cttagtataa ttcactgtcc aggacatcaa
    4501 aaaggaaaca gtgctgaggc cagaggcaac cgtatggcag atcaagcagc ccgagaggca
    4561 gccatgaagg cagttctaga aacctctaca ctcctcatag aggactcaac cccgtatacg
    4621 cctccccatt tccattacac cgaaacagat ctcaaaagac tacgggaact gggagccacc
    4681 tacaatcaga caaaaggata ttgggtccta caaggcaaac ctgtgatgcc cgatcagtcc
    4741 gtgtttgaac tgttagactc cctacacaga ctcacccatc tgagccctca aaagatgaag
    4801 gcactcctcg acagagaaga aagcccctac tacatgttaa accgggacag aactatccag
    4861 tatgtgactg agacctgcac cgcctgtgcc caagtaaatg ccagcaaagc caaaattggg
    4921 gcaggggtgc gagtacgcgg acatcggcca ggcacccatt gggaagttga tttcacggaa
    4981 gtaaagccag gactgtatgg gtacaagtac ctcctagtgt ttgtagacac cttctctggc
    5041 tgggtagagg cattcccgac caagcgggaa actgccaagg tcgtgtccaa aaagctgtta
    5101 gaagacattt ttccgagatt tggaatgccg caggtattgg gatctgataa cgggcctgcc
    5161 ttcgcctccc aggtaagtca gtcagtggcc gatttactgg ggatcgattg gaagttacat
    5221 tgtgcttata gaccccagag ttcaggacag gtagaaagaa tgaatagaac aattaaggag
    5281 actttgacca aattaacgct tgcatctggc actagagact gggtactcct actcccctta
    5341 gccctctacc gagcccggaa tactccgggc ccccacggac tgactccgta tgaaattctg
    5401 tatggggcac ccccgcccct tgtcaatttt catgatcctg aaatgtcaaa gttaactaat
    5461 agtccctctc tccaagctca cttacaggcc ctccaagcag tacaacaaga ggtctggaag
    5521 ccgctggccg ctgcttatca ggaccagcta gatcagccag tgataccaca ccccttccgt
    5581 gtcggtgacg ccgtgtgggt acgccggcac cagactaaga acttagaacc tcgctggaaa
    5641 ggaccctaca ccgtcctgct gacaaccccc accgctctca aagtagacgg catctctgcg
    5701 tggatacacg ccgctcacgt aaaggcggcg acaactcctc cggccggaac agcatggaaa
    5761 gtccagcgtt ctcaaaaccc cttaaagata agattaaccc gtggggcccc ctgataatta
    5821 tggggatctt ggtgagggca ggagcctcag tacaacgtga cagccctcac caggtcttta
    5881 atgtcacttg gaaaattacc aacctaatga caggacaaac agctaatgct acctccctcc
    5941 tggggacgat gacagacact ttccctaaac tatattttga cttgtgtgat ttagttggag
    6001 acaactggga tgacccggaa cccgatattg gagatggttg ccgctctccc gggggaagaa
    6061 aaaggacaag actatatgat ttctatgttt gccccggtca tactgtatta acagggtgtg
    6121 gagggccgag agagggctac tgtggcaaat ggggatgtga gaccactgga caggcatact
    6181 ggaagccatc atcatcatgg gacctaattt cccttaagcg aggaaacact cctaagggtc
    6241 agggcccctg ttttgattcc tcagtgggct ccggtagcat ccagggtgcc acaccggggg
    6301 gtcgatgcaa ccccctagtc ctagaattca ctgacgcggg taaaagggcc agctgggatg
    6361 cccccaaaac atggggacta agactgtatc gatccactgg ggccgacccg gtgaccctgt
    6421 tctctctgac ccgccaggtc ctcaatgtag ggccccgcgt ccccattggg cctaatcccg
    6481 tgatcactga acagctaccc ccctcccaac ccgtgcagat catgctcccc aggactcctc
    6541 gtcctcctcc ttcaggcgcg gcctctatgg tgcctggggc tcccccgcct tctcaacaac
    6601 ctgggacggg agacaggctg ctaaacctgg tagaaggagc ctacctagcc ctcaacctca
    6661 ccagtcccga caaaacccaa gagtgctggc tgtgtctagt atcgggaccc ccctactacg
    6721 aaggggtggc cgtcctaggt acttactcca accatacctc tgccccggct aactgctccg
    6781 tgacctccca acacaagctg accctgtccg aagtgaccgg gcagggactc tgcataggag
    6841 cagttcccaa aacccatcag gccctgtgta ataccaccca gaagacgagc gacgggtcct
    6901 actatttggc ctctcccgcc gggaccattt gggcttgcag caccgggctc actccctgtc
    6961 tatctactac tgtgcttaac ttaaccactg attactgtgt cctggttgaa ctctggccaa
    7021 aggtaaccta ccactcccct aattatgttt atggccagtt tgaaaagaaa actaaatata
    7081 aaagagagcc ggtgtcatta actctggccc tgctgttggg aggacttact atgggcggca
    7141 tagctgcagg agttggaaca gggactacag ccctagtggc caccaaacaa ttcgagcagc
    7201 tccaggcagc catacataca gaccttgggg ccttagaaaa atcagtcagt gccctagaaa
    7261 agtctctgac ctcgttgtct gaggtggtcc tacagaaccg gaggggatta gatctactgt
    7321 tcctaaaaga aggaggatta tgtgctgccc taaaagaaga atgctgtttt tacgcggacc
    7381 acactggcgt agtaagagat agcatggcaa agctaagaga aaggttaaac cagagacaaa
    7441 aattgttcga atcaggacaa gggtggtttg agggactgtt taacaggtcc ccatggttca
    7501 cgaccctgat atccaccatt atgggccctc tgatagtact tttattaatc ctactcttcg
    7561 gaccctgtat tctcaaccgc ttggtccagt ttgtaaaaga cagaatttcg gtagtgcagg
    7621 ccctggttct gacccaacag tatcaccaac tcaaatcaat agatccagaa gaagtggaat
    7681 cacgtgaata aaagatttta ttcagtttcc agaaagaggg gggaatgaaa gaccccacca
    7741 taaggcttag cacgctagct acagtaacgc cattttgcaa ggcatggaaa agtaccagag
    7801 ctgagttctc aaaagttaca aggaagttta attaaagaat aaggctgaat aacactggga
    7861 caggggccaa acaggatatc tgtagtcagg cacctgggcc ccggctcagg gccaagaaca
    7921 gatggtcctc agataaagcg aaactaacaa cagtttctgg aaagtcccac ctcagtttca
    7981 agttccccaa aagaccggga aataccccaa gccttattta aactaaccaa tcagctcgct
    8041 tctcgcttct gtacccgcgc tttttgctcc ccagtcctag ccctataaaa aaggggtaag
    8101 aactccacac tcggcgcgcc agtcatccga tagactgagt cgcccgggta cccgtgttcc
    8161 caataaagcc ttttgctgtt tgcaa

    or go to
  3. Sasha

    Sasha Fine, thank you

    Reckon you'll be talking among yourselves on this one, guys! :D:D:D
  4. Kati

    Kati Patient in training

    Are we back to Commodore 64's DOS???
  5. Countrygirl

    Countrygirl ME is not MUS



  6. CBS

    CBS Senior Member

    It's not DOS but you're not far off (see 'Quaternary numeral system'). As for myself, some days I feel like I'm trying to run Vista on a Commodore.:headache:
  7. George

    George Guest


    Yeah, makes your eyeballs cross doesn't it!? (grins)

    I'm no geneticist but I can tell you what I know about what's written here. (ain't much (Big grings))

    If you look at the part that's labeled with numbers; Starts with 1 and ends with 8161 That's all the "nucleotides" that make up the virus. Each one is a protein. Different sets of proteins will create different things. Like a little "capsid" or envelope around the virus. Or it might be a sequences that is used to fool the immune system from trying to eat it.

    In HIV the "cg" set of proteins only shows up in the genome 0.88% of the time. Because there aren't very many "cg" sets it get's by the immune system which looks for "cg" sets when it looks for things to destroy. In XMRV the "cg" sets are only 3.75% so they fool the immune system some of the time so there must be 'something' else that allows it to hide out or not to be gobbled up by our immune cells. Still the 3.75% is only about half of what you would expect to show up on a genome this long.

    Warning Speculation Ahead (grins) It's ability to penetrate the bodies core systems including digestive (GI), reproductive (but not uterine, which is interesting) and immune systems (lymph glands) means that it either encodes a protein sequence that the body recognizes as needed (not likely) or it turns off the bodies ability to recognizes it as a threat. (most likely, see Gerwyns post on the why we don't get colds thread)

    This is all so cool!
  8. Gerwyn

    Gerwyn Guest

    Thanks george my computer is on the blink so I may go silent for a while---I will be back!
  9. Gerwyn

    Gerwyn Guest

    Hi george my speeds are down to dial up--can you find the missing sequences in the inactivated clone in the last london study Bones in it(laughs)
  10. George

    George Guest

    UK sequences used for the PCR

    Genomic (g)DNA was prepared from PBMC from SGUL patients and controls using the QIAamp DNA mini kit (Qiagen) and amplified using the RepliG Ultrafast Mini Kit (Qiagen), which provides highly uniform amplification of all sequences, with negligible sequence bias. The concentrations after amplification ranged from 108 - 586 ng/Ml. Initially, 48 CFS patient gDNA samples were screened by single-round PCR for gag and env genes, as well as GAPDH, as outlined by Lombardi et al. [8] (Table 1).

    This PCR was performed in a 50 Ml reaction volume consisting of 25 Ml
    amplitaq gold PCR mastermix and a final DNA concentration of 2-5 ng/Ml. Cycling was modified as appropriate to our mastermix; 95 oC for 5 min, (95 oC for 30 sec, 57 oC for 30 sec, and 72 oC for 60 sec) for 45 cycles, hold at 72 oC for 7 min, store at 4 oC. Products were visualized on 3% agarose gels by ethidium bromide staining.

    As we did not amplify any products using this PCR, we developed two more sensitive real-time qPCR assays which targeted 2 regions of the env gene, beginning at nt 6173 and 6682, respectively (Table 1).

    These were used to screen samples of gDNA (prepared from PBMC) or cDNA (prepared from total RNA extracted using the Paxgene system from Preanalytix, UK) from CFS and normal blood donors. In total, 136 CFS gDNA and 140 CFS cDNA samples and 95 control gDNA and 141 control cDNA samples were analysed, such that all 142 CFS patients and 157 blood donors were screened for XMRV using these assays in either genomic DNA, cDNA or both.

    GAPDH was also amplified as a control using a commercial primer and probe set
    (Hs_99999905_m1 from Applied Biosystems). Real-time qPCR reactions were
    performed in 10 Ml total volume, consisting of 5 Ml PCR mastermix, 0.5 Ml (20x) Taqman primers/probe mix, 4.5 Ml sample (for gDNA, 1 Ml gDNA (100-590ng) and 3.5 Ml DEPC-treated water (Ambion); for cDNA, 4.5 Ml cDNA). Cycling times and temperatures were as follows. Initial denaturation occurred for 10 min at 95 C, followed by 40 cycles of denaturation at 95 C for 15 sec and combined primer annealing/extension at 60 C for 1 min. Data were displayed using SDS 1.3.1 software (ABI).
  11. Dr. Yes

    Dr. Yes Shame on You

    Gerwyn, you're not actually going to try and manually compare the sequences to see if the UK inactivated clones were missing the regions to which, as reported in the SF retrovirology conference, human antibodies were found -- are you?!?

    If so, I will take my hat off to you. :Green hat:
  12. Gerwyn

    Gerwyn Guest

    I,ve had a quick look but it will take a day or two!i,m particulary interested on the splicing areas the integrase enzyme and the sites of insertion re NO synthase TGFbeta and finally its potential to upregulate the beta interferon gene.I am interested in this unique env sequence.Retoviruses have evolved into gene switches so this bug could do a lot more than appears possible at first glance
  13. Gerwyn

    Gerwyn Guest

    Hi Dr Yes,
    I realise how garbled my last post was.There is a gene encoding for inducible nitric oxide synthase called Nos20.if stimulated it produces high enough levels of nitric oxide to directly and irreperably damage mitochondria deplete glutathione and other immune nastys.Hyperstimulation of this gene is thought to exist in Hep C infections.Leaving this gene switched on or its inhibitor switched of could cause the immune cascade postulated in ME.Obviously speculation but endos have been known to do similar things with other genes so I,m having a look!
  14. Alesh

    Alesh Senior Member

    Czech Republic, EU
    I am not a biologist but I have some software that is able to do some bioinformatics' computation, so just out of curiosity I compared the first 14 letters "from the virus": GCGCCAGTCATCCG with the human genome, here is the result:

    (Chromosome11, 1), (128210571, 128210584)

    Actually I could find the longest such subsequence "from the virus" which is identical to a sequence in human genome or I can list them all with some limit on their length. But I absolutely have no clue what it could be useful for ;) :)
  15. Gerwyn

    Gerwyn Guest

    Oh yes please that would save me hours!i,m looking for possible insertion sites and hence ability to upregulate or down regulate genes and or to induce polymorphism of the gene which in the end produces nitric oxide
  16. spindrift

    spindrift Plays With Voodoo Dollies

    Would that be a good or bad thing in terms of treatment/cure?
  17. Gerwyn

    Gerwyn Guest

    Could be amenable to transposon led gene therapy.if it is in fact happening and weknow the sequences to target
  18. Advocate

    Advocate Senior Member

    Gosh, I love science nerds! :victory: Even if they are dogs or gibbons, otherwise.;)
  19. Alesh

    Alesh Senior Member

    Czech Republic, EU
    Today I was just able to find all subsequences of length 20 from the virus in the human genome. These are as follows:

    From XMRV:
    GTCTTTGTGCGTGTGTGTGT: ("Chromosome15", 1), (59912998, 59913017)

    GATGAGCAGAGAGAGAGAGA: ("Chromosome1", -1), (225509884, 225509903)
    ("Chromosome2", -1), (77761826, 77761845)
    ("Chromosome22", 1), (17936465, 17936484)

    CCAGGAAAGAGCCAGATGTT: ("Chromosome1", -1), (191208767, 191208786)

    CTAAGGGAGTTCCTAGGGAC: ("Chromosome11", 1), (22297057, 22297076)

    AGAAGGCAGAGAAATTAAAA: ("Chromosome17", -1), (68495483, 68495502)

    GGAAGCCATCATCATCATGG: ("Chromosome22", -1), (15359028, 15359047)

    AGGGCCCCTGTTTTGATTCC: ("Chromosome1", -1), (153005828, 153005847)
  20. Alesh

    Alesh Senior Member

    Czech Republic, EU
    Now I realize I made a mistake in my code: these are not all of them, just some of them. It's 3:30 a.m. here. Good night. :)

See more popular forum discussions.

Share This Page