1. Patients launch a $1.27 million crowdfunding campaign for ME/CFS gut microbiome study.
    Check out the website, Facebook and Twitter. Join in donate and spread the word!
Entrevista: la apelación del millón de dólares de Ian Lipkin para un estudio en el Microbioma
Simon McGrath se aseguró recientemente una entrevista con el mundialmente famoso doctor Ian Lipkin - un científico que sigue creyendo que EM / SFC tiene una causa física - para descubrir más sobre sus planes para un importante estudio del microbioma intestinal y para averiguar por...
Discuss the article on the Forums.

Another negative XMRV CFS study - is this new? looks to be from CDC

Discussion in 'XMRV Research and Replication Studies' started by Jemal, Feb 22, 2011.

  1. kurt

    kurt Senior Member

    Messages:
    1,132
    Likes:
    173
    USA.Earth
    Omnerbasket,
    You seem to think that calibrating a PCR test is not enough to ensure that the test will find the sequence it was calibrated for. I really don't think the argument you are using works well, particularly because WPI used the same calibration target as most of the other tests. You seem to be suggesting that a PCR test, designed by WPI, which is calibrated to VP62, is somehow more reliable than a test designed by another lab, also calibrated to VP62, if they do not have the same finding. Who made WPI the reference here? Their findings are just as subject to confirmation as anyone else's. And most of their secondary testing rests on the validity of their original PCR test. So this IS a major issue.

    If there is a difference in two PCR tests calibrated to the same sequence, either one of them is wrong (unlikely), or one of them has sample differences (very likely). What makes those samples different is probably the primary mystery to solve.
  2. omerbasket

    omerbasket Senior Member

    Messages:
    510
    Likes:
    13
    Kurt, perhaps you want to read what I've written again, because that is not what I said. I don't think that Switzer's assay, for example, is worse than the WPI's one in finding a sequence that is 100% identical to VP62. It's at least as good as the WPI's one at that - do you understand, or should I repeat that?
    What I said is a whole other thing: The WPI may have calibarated their assay against VP62 (I don't remember, but I think that they did), like Switzer and others. But the WPI's assay - and Dr. Mikovits explained why in her lecture in January - has the ability to find sequences that are more diverse from VP62 than the ability of Switzer's assays, it seems.

    There is a third and very important option: It could be that one of them can find more diverse sequences (than the reference sequence) than the other. Just the fact that you check your assay against a certain sequence, does not mean by any way that it cannot detect other sequences. It does not mean that it can - but as I said earlier, Dr. Mikovits explained why it's reasonable that the WPI's assay would detect more diverse sequences. As I also said earlier, WPI have sequences every positive they found until today. Therefore, the diversity of their sequence does not mean that they would find something other than an MLV-like virus and think that they found an MLV-like virus. This is well-controlled.

    PCR is a chemical reaction. If you set your test to check for "does he have 500,000 dollars" and he really have "just" 499,999 dollars, the answer the machine would give you is "no". But life is much more complicated than that.
  3. kurt

    kurt Senior Member

    Messages:
    1,132
    Likes:
    173
    USA.Earth
    'Should I repeat that?' Please, no insults. Does not do your argument any credit.

    OK, that possibility (the third option you propose) is beyond my understanding of PCR, so I will study this issue before replying. The idea that some PCR tests can find more diverse sequences, if that is true then the validity of different PCR designs is far more flexible than I have been led to believe...
  4. Cort

    Cort Phoenix Rising Founder

    Messages:
    7,025
    Likes:
    423
    Raleigh, NC
    I showed this to a researcher - and asked are they just not doing this? and he just about hit the roof. He said that optimizing the magnesium in PCR's is taught in high school (didn't know they were doing PCR's in high school now :)). Its a very basic step that every lab in the country does. Suggesting that this was the reason nobody else was finding XMRV he felt made Dr. Mikovits look ludicrous, honestly.

    Dr. Mikovits forte is apparently not PCR - it's culture. Notice the article says she turned to her graduate student to optimize the PCR and he in turn had to research how to do this very basic step. Neither of them appear to have much experience in PCR.

    Another gaffe that apparently set the research communities teeth on edge was re-using a glass pipette twice - thus contaminating the negative control in the BWG test- turning it positive. That's a very basic mistake. Its standard procedure to use a glass pipette on one sample - destroy it (they're cheap) and then use a new one on the next one....To have it happen on these important five samples was alarming.

    Dr. Mikovits said that her graduate student had done that. One retrovirologist wondered why a graduate student was handling these precious samples but the article suggests that this graduate student is basically the one in charge of the PCR.
  5. Cort

    Cort Phoenix Rising Founder

    Messages:
    7,025
    Likes:
    423
    Raleigh, NC
    Actually as it was explained to me it's just the opposite...later tests have been much more diverse than earlier ones and are looking for more sequences.This is because the knowledge of XMRV was more primitive a year and a half ago. Now that researchers have been pouring over XMRV they know where the stable sequences are and how to target them - so they are casting their net alot wider.

    The recent Satterfield paper was a case in point. They were able to use antibodies that had been developed to a wide variety of proteins found in XMRV. The WPI paper used an antibody test for a protein found in MLV's with the idea that XMRV would probably have a similar protein. That made sense and it was all they could do at the time.

    The WPI actually ended up missing some aspects of XMRV with the PCR because they didn't know about the 20bp deletion. When they found out about that they started using a new PCR test. (I was told they started using Singh's). The WPI's test has gotten better but so has everybody else's. Everybody is getting better at finding XMRV.

    Alot of labs have different strains of XMRV now as well. As Dr. Bateman noted - every paper sets a new standard for the next paper. Journals aren't interested in seeing the same paper again and again - you have to show something new....
  6. Cort

    Cort Phoenix Rising Founder

    Messages:
    7,025
    Likes:
    423
    Raleigh, NC
    I just keep going back to the original paper - I got utterly stuck on that about a month ago. XMRV was not hard to find in the original paper. They found it in 4% of controls and 67% of CFS patients. They didn't have to go to extraordinary lengths to look for it. ..they didn't have to culture, they didn't have to use the 'wild-type' virus to validate it, they were able to validate it using VP62, they didn't have a particularly sensitive PCR...so why is the virus now, all of a sudden, on the limits of detection of PCR?

    I am just completely stuck on that.

    The only thing I can think of is the freezing-refreezing issue that Dr. Mikovits talked about. She basically said that was the problem in her last talk - we haven't heard anything since then, though.
  7. jace

    jace Off the fence

    Messages:
    855
    Likes:
    170
    England
    I make no apologies for quoting omerbasket's excellent post. I have broken up the long paragraphs, in order to make it easier to read for pwME

    PCR is a very valid technique for a yes or no question regarding specific conditions. It's like a polygraph.

    If I'm being investigated because the police suspect that I have too much money in my bank account and therefore it must be stolen, and let's say that the police thinks that anything beyond 2,000 dollars for me is more than I should have had if I didn't steal anything, and let's assume that I actually have 499,999 dollars in my account - if the polygraph guy asks me "Is it true that you have 500,000 dollars in your bank account" and I say: "No", the lie detector would probably show that I lied.

    So the police will then think that I have something to hide - because they have knowledge of me having about 500 thousand of dollars, and yet I say "No", and the polgygraph is showing that I lied. But what can I do - even though the money that I really have in my bank account would confirm what they are thinking, I really don't have 500,000 dollars there.

    If PCR was able to find out if we have said the truth or not, the way it can find out if certain DNA/RNA strains are in a sample - we would have a much better machine then a polygraph in order to find out whether someone is telling the truth or whether that someone is lying. However, if the situation was as was the situation that I mentioned above, PCR would also say that I'm lying. And it would also be correct. And yet, it would also divert the police from the truth, since they really really don't care if I have 499,999 dollars or 500,000 dollars.

    And we really dont care if the strain is GTTCGGATTCGGTTTCCCAAAAAT or GTTCGGGATTCGGTTTCCCAAAAAT. But with some PCR conditions, you might find the first strain - which would be the strain that you cloned in order to calibarate your assay, but not find the second strain, which might be the strain that was in the blood of the patient. Should the patient care if another G enters there, somewhere?

    Probably not, and it would probably have no effect, or a very very minor effect on the possibilities of treatment. But a PCR test might tell him that he doesn't have "XMRV", while infact he have a strain of XMRV (which is a name of more than one genetic strain) that this PCR test cannot find.

    False and misleading. First of all, replication of the Lomardi et al study means to do every single test that they did, on patients meeting the exact same criteria. That mean Canadian Consensus Criteria, and performing each of the following:
    - nested PCR for gag and env.
    - Intracellular flow cytometry
    - Western Blot.
    - Isolating B and T cells from a patient and testing it for antibodies.
    - Co-culture activated lymphocytes with LNCaP.
    - Incubate LNCaP cells with plasma samples and check for XMRV and test by PCR and IFC.
    - Check by flow cytometry if the blood is reacting with a mouse B cell line expressing recombinent SFFV Env and not with samples without SFFV Env.
    - See if the plasma is blocking the binding of the SFFV Env mAb to SFFV Env on the cell surface.

    But doing all these would still not be a replication study. Let's see what the dictionary can tell us about "replication":
    a copy; biology:the production of exact copies of complex molecules, such as DNA molecules, that occurs during growth of living organisms.

    So what does that tell us, kids? Right! Every test that we do must be done exactly as the WPI did it. Not "very much like", not "it's not the same but it should have worked". Exactly.

    A replication study would mean to do the exact same things as were done in the first study, and do them all. Select the patients by the same criteria, take the same amount of blood that was taken from them in the first study, put it in the same kind of tubes, store it exactly the same, process it the same and check it the same.

    Some parts are almost impossible - they probably don't want to store those samples now for 2-3 years. But unless they did that, they cannot say that they have made a replication study. But while no one asks for the samples to be stored for 3 years before testing, we do ask for other things, that are very much possible to do: Choose patients by the same criteria; Process the samples exactly the same; Do all of the tests; And do the tests exactly as they were done by the WPI.

    Ugly. I believe that while Dr. Mikovits would be remembered as a great scientists in the history of the virology world, the persons who wrote this digusting letter would probably not be remembered at all, and if they would be remembered, they would be remembered as those that not only couldn't find XMRV even though it's very real, but also decided to throw mud at the scientist who discovered it's connection to ME/CFS and possibly other diseases too.

    The sentence about structures is correct, but the meaning behind this sentence is entirely misleading. I said it before, and I'll say it again: Let's say that you have a PCR test that would only find a virus if it has 99,236 nucletoides. You check a sample with a virus that have 99,238 nucleotides, and you don't find it.

    The difference of 2 nucletoides means nothing in reality, but the test would come back with a "negative" instead of a "positive". The WPI designed their tests in order to be able to find a virus that has many strains that are called together "XMRV". They tweaked their tests in order to find the best way to discover it. They also had luck.

    Let's say that they found the 99,236 nucleotides virus. Now, Cooperative Diagnostics is checking with a test that would find a virus if it has the exact 99,236 nucletoides in the same order. But what can we say, the virus has changed a little bit and instead of having a G somewhere after 40,000 nucleotides, it has a C there.

    Cooperative Diagnostics don't find it and say that there was not XMRV there. What are you telling me, that everytime that a nucleotide is changing in a virus we should call it by a different name? As the doctor who saved the lives of millions around the world said, it's not that HCV is one virus - it's a whole lot of similar viruses called by us humans by the same name.

    It's not that their tests wouldn't recognize a virus if it had a single nucleotide change from 99,236 nucleotides. But it's also not that a retrovirus found in different time at different zones is expected to have a single nucleotide change and leave the other 99,235 nucleotides as they were.

    PCR has it's limits, like all of the other assays - but some PCR assays have more limits regarding our certain case than others. Therefore, before you can even think to yourself that there is no XMRV here, you should perform the PCR test that was proven to be able to find XMRV in clinical samples before - because unlike when you calibarate your test with virus clones, in a clinical sample you don't know what the exact sequence is until you sequence the virus.

    And probably all of the 101 patients in the "Science" study had somewhat different sequences from one another, and a test that could find a certain sequence whenever it's there, might not be able to find a very very similar sequence, if it's too specific. In the study of Lo et al., and as we know also in the study of Dr. Hanson, they found somewhat different sequences, but that does not change anything important - because it can be expected, retroviruses mutate.

    Dr. Mikovits already showed in her lecture in January how one would not have found the Lo/Alter viruses using a certain PCR test, but would have found it using the test that the WPI developed after working very hard in order to do that.

    But even if you work very hard in order to develope a PCR test that would found any MLV-like virus, your assay might still not be able to perform that. Since we don't know all the sequences out there, we cannot know that our assay detects them all. Or even most, or even 10% of them. Therefore, it's important to use other methods as well. And those methods should be able to find a very broad spectrum of MLV-like viruses as well. As I said, at least right now, it does not matter what you call it, as long as it's a MLV-like virus. 40% like the WPI's virus is not enough, but 85%, 90% is very very much enough.


    Validated for what? GGCCTTAAACCCCCTGTTTGGG? Or GGCCTCAAACCCCCTGTTTGGG? So yes, you can validate that your assay would find GGCCTTAAACCCCCTGTTTGGG if it has about 10 copies there. But you can't validate that it would find any virus that is "only" 96% identical to your clone. and since 96% identical might very well be enough, that is of huge importance.

    So again, that is why you have to have a PCR that would discover a very broad spectrum of sequences, and to also test it by other ways.

    For example: Dr. Singh found 6% of the prostate cancer patients that she tested to be positive for XMRV by a PCR test; But She also found another 21% to be positive for XMRV, or at least a gammaretrovirus, by immunohistochemistry. So what do Cooperative Diagnostics say, that all of these 21% that the PCR didn't find to be positive must be negative?


    So does Dr. Mikovits, with her 30 years experience in retrovirology. So does Dr. Hanson. So does the co-discoverer of HTLV-1, Dr. Francis Ruscetti. So does the co-discoverer of Hepatits C and Hepatitis C virus (and a contributer to the finding of HBV), the 75 years-old Dr. Harvey Alter.

    If you say that Drs. Ruscetti and Alter can be wrong, so does these doctors who are "among the world's most accomplished in the design of PCR diagnostics". It's only human. But it's more human with a method that might be too specific in order to find unknown strains of viruses.

    First of all, that's 2 positives, since the Lo/Alter paper clearly confirmed the WPI's findings, even if the sequences were only similar and not identical, and good virologists should know that it's likely that a retrovirus would mutate. Second of all - what kind of scientist begins to measure how much papers are in favour and how much oppose?

    It's like I've said many times: If I have VP62 on the floor, and I decide that if I will put some cola on that the floor would turn green - and I do that a hundred times and the floor stays white - that doesn't mean I don't have VP62 there. It means that my test couldn't find it.

    And if I have a virus that is 95% identical to VP62, but my test can only find a virus that is 95.1% identical to VP62, even if the test is perfect at finding these >=95.1% identical-to-VP62 strains, it would still say "negative", but the interpertation is not that there is no MLV-like virus there, the interpertation is that there is not 95.1%-identical-to-VP62 strain there.

    It's not 100% since the Lo/Alter paper is in agreement with the "Science" paper, which by itself checked his samples in 3 seperate laboratories, and the studies of Dr. Hanson and Dr. De-Merleir are also in agreement with the "Science" paper, and also the findings of VIP Dx and RED Laboratories are in agreement with the "Science" paper.

    These were not replication study and the fact that McClure and Huber did not take appropriate measures to avoid contamination says very little, if anything. The WPI clearly took great measures to show that it's not a contamination, as was also done in the Lo/Alter study.

    No one found that it was a contaminant, if anything they just showed that it's, in their very biased opinion, likely, and I really tend to believe that many, more known and experienced researchers, would disagree with them.

    This was found to be a human DNA strain by the WPI itself, by sequencing, a process that they have done with any of the hundreds of positives that they found during the last 2 years. And if Dr. Simmons said he is not concerned with that, than why should I listen to Cooperative Diagnostics?

    What picture do most scientists see now? I doubt if it's the picture that Dr. Mikovits, Dr. Francis Ruscetti, Dr. Sandra Ruscetti, Dr. Lo, Dr. Hanson, Dr. De-Merleir, Dr. Singh, the scinetists at VIP Dx, the scientists at RED Laboratories, the scientists from the spainish hospital and many others see.

    I doubt if that's the picture that the discoverer of Hepatits C and Hepatits C Virus and the person that was awarded the Distinguished Service Medal, the highest award conferred to civilians in United States government public health service, the 2000 Albert Lasker Award for Clinical Medical Research and the American College of Physicians Award for Outstanding Work in Science as Related to Medicine (and that's not all of it), Dr. Harvey Alter, sees:

    'But I still want to counter by saying I think the current evidence for disease association is very strong, even though not universally confirmed. But it has been confirmed now in at least four studies, two of which were presented today, that either XMRV or a polytropic MLV is associated strongly with chronic fatigue syndrome.

    A point that I think was misrepresented today: In those labs who do find the agent, it is very reproducible. Judy has found the same patients to be positive by culture year after year. We have found a patient to come back after 15 years and still be positive. So this is not a single, isolated finding. It's confirmed by sequencing. It's reproducible over time.

    Dr. Hanson has shown today how critical the assays are. When she tweaked her assay, she went from no findings to findings almost identical to the Lo lab. The diversity is now being confirmed also in the original WPI group. XMRV isn't the only agent even in the WPI lab.

    Despite the very legitimate concern for contamination -- I think this is a serious issue -- there have been hundreds of negative controls in the same laboratory that are always consistently negative. An extremely sensitive mouse mitochondrial DNA has always been negative in the Lo laboratory.

    Lo has done the IPA assay that Dr. Coffin recommended. That is also negative. There just has been no evidence for contamination. Although you could say maybe the negatives could be negative somehow and the positives positive for contamination reasons, it really is not logical that that would be so.'
  8. natasa778

    natasa778 Senior Member

    Messages:
    1,250
    Likes:
    844
    London UK

    Satterfield is a charlatan.

    Lets put a stop to this rubbish please.
  9. omerbasket

    omerbasket Senior Member

    Messages:
    510
    Likes:
    13
    Cort, this is going to be very personal, and that is because I'm getting tired of trying to convince people who act as if they are the enemy:
    It's seems that almost everything that is explained to you goes against the WPI's finding. But their finding are not just their, it's also the findings of the person who co-discovered HTLV-1 and of his wife, an expert in MLVs and the findings of the Cleveland Clinic. And there are many indepedent doctors who believes the WPI were great at what they did - you can just read what Dr. Alter wrote about the WPI's study in his lecture from which we got to know of his study that is confirming WPI's one. Why don't you ask this kind of researchers too?

    And by the way, culture and PCR are not different tests. In order to test the sample that you co-cultured, you use PCR. It's just that now there are many more copies of the virus there - if there was virus there to begin with.
  10. Cort

    Cort Phoenix Rising Founder

    Messages:
    7,025
    Likes:
    423
    Raleigh, NC
    I don't that think that was very personal Omerbasket and I actually appreciate your comment. All the experts lined up on opposite sides makes it really difficult. Now you have experts saying diametrically opposed things. For a long time I felt, given Dr. Ruscetti and Dr. Silvermans and everyone else's expertise, that XMRV could not fail and I really highlighted the fact that Dr. Alter is a Lasker award winner and Dr. Ruscetti is the co-discoverer of HTLV and so on..Its really confusing....I thought how could they be wrong???

    I just think - and I'm just a laymen obviously - that it doesn't look like its going to work out. Just a personal opinion....

    These strange mistakes get to me as well...talking about PCR optimization as if no one else was doing it........what do you do with that? Was he misquoted? Quoted out of context? It seemed like a pretty clear quote. I pulled up Wikidpedia page on PCR optimization - http://en.wikipedia.org/wiki/Pcr_optimization - and there it is; one of a handful of basic techniques that are used to optimize PCR....yet Dr. Mikovits graduate student is suggesting that PCR research labs aren't doing this....or diagnostic labs that do this for a living...aren't doing this....
  11. omerbasket

    omerbasket Senior Member

    Messages:
    510
    Likes:
    13
    So I thought I'd like to bring some stuff that another scientist said. This is a scientist with a 30 years experience, who have worked for many years in the National Cancer Institute. It's Dr. Judy Mikovits.

    First, look at the following image (from her lecture in Januray). It is showing sequences found in a CFS patient from the original "Science" study, a patient who the WPI later found has also PMRV (aside from XMRV). It also shows known sequences of some retroviruses. Here is the picture:
    [​IMG]
    Now, I'm gonna qute her (remember this wasn't written but said in a lecture, so it might not be the most easy thing to read):
    By the way, I advise you to watch that part of her lecture (and it would ofcourse be best if you decide to watch her entire lecture) in here:
    http://bcove.me/bxfbpduo
  12. omerbasket

    omerbasket Senior Member

    Messages:
    510
    Likes:
    13
    First of all - Cort - it's really not expected from a person that has a forum for ME/CFS sufferers to write publicly about these sufferer's best option in decades to recover some health that you "just think - and I'm just a laymen obviously - that it doesn't look like it's going to work out". Every word might get us farther from scientists exploring this issue until there is no more controversy and everone agrees (and hopefully, everyone would also be right when they agree).

    Second of all - a person sees what he wants to see, and altough it might apply regarding me as well, I think that you saw what you wanted to see in the quotes of Dr. Mikovits and of Max Pfost. They did not just discover about optimization of PCR, and about magnesium having a role there. This is what they have said:
    You should understand that researching for PCR otpimization does not mean "learning PCR optimization" - it means researching for how to best optimize your PCR assay to what you need the assay to detect. If you want it to detect just a sequences 100% identical to a known sequence, you would optimize your assay one way, and if you want it to detect also sequences that are "just" 90% identical to a known sequence, you would optimize it another way. Pfost probably researched for how to best optimize your assay so that it would detect a broad spectrum of sequences on the one hand, but that they will be MLV-like sequences on the other hand.
    I'd expect you to have a little bit more wisdom in order to understand that Dr. Mikovits - whatever you might think of her - has the knowledge that optimizing PCR is a basic stage that everyone does - and that she meant that they needed to best optimize their PCR for the specific needs that they have from the tests. Also, When Pfost is talking about people "not taking the time to optimize their PCR", he probably means that either they are not giving enough time to this process (you can give something 5 seconds and give something 10 months - and in both cases you will be giving it time, so obviously it's not what he meant - since he has more knowledge than you in PCR and even you know that you have to give sometime - a little or a lot - in order to optimize PCR), or they are not giving enough importance to optimizing it in order to find a broad enough spectrum of sequences.

    From the words in bold you can understand that she did not mean that you just have to "optimize the PCR assay" - which is obvious, but what she meant is that you have to do that right, and the right wat with a new, mutating virus would be to optimize it to find a broad enough spectrum of sequences.
  13. cigana

    cigana Senior Member

    Messages:
    448
    Likes:
    98
    UK
    Omerbasket, this is great puzzle-solving science. Mikovits has gone beyond the usual "I'm right you're wrong" statements (that most of the negative authors seem to use) and has actually worked out a possible reason to explain all of the confounding results so far - well done to her for actually engaging in scientific thought and giving reasons.
  14. kurt

    kurt Senior Member

    Messages:
    1,132
    Likes:
    173
    USA.Earth
    Omerbasket, sorry this took so long, so much going on, but I said I would reply after some research. And I found no reason WPI's assay would detect more diverse sequences than the others. In fact, a comparison of sequences shows the opposite, the negative studies using the conserved region of the MLV genome would detect more diverse sequences. Maybe Mikovits is referring to something undocumented. Anyway that is what I tracked down.

    The claim that WPIs test can detect a greater number of strains by virtue of better primers can be tested. A researcher could look at the members of the MLV family WPI's primer can bind to and compare that with the number other lab's primers can bind with.
  15. omerbasket

    omerbasket Senior Member

    Messages:
    510
    Likes:
    13
    I'm surprised that you found "no reason WPI's assay would detect more diverse sequences than the others". For a good reason, you can read my post with the quote from Dr. Mikovits.

    Anyway, that is just one reason for the discrepancy. There are a few other reasons, I believe. If you do the PCR correct, but do other steps wrong, you might still get it wrong.
  16. kurt

    kurt Senior Member

    Messages:
    1,132
    Likes:
    173
    USA.Earth
    WADR, the opinion of Judy Mikovits is not data. I am looking for some evidence that a PCR test with primers binding with FEWER strains can detect more diverse sequences than a PCR test with primers binding to MORE strains in a given viral family such as MuLV. Do you have a quote from Mikovits that states the source of her view? Is there data for this?
  17. omerbasket

    omerbasket Senior Member

    Messages:
    510
    Likes:
    13
    Source for her view? I don't know - perhaps years of learning of microbiology in the university? Or three decades of working as a retrovirologist?

    By the way, the opinion of Cooperative Diagnostics is alson not data. it's even incorrect in many things, and for that you can read quite a few posts on this forum that would tell you why.
  18. Cort

    Cort Phoenix Rising Founder

    Messages:
    7,025
    Likes:
    423
    Raleigh, NC
    As I pointed out in the earlier post I took that section and asked "what about this? Are labs missing this? Are labs not optimizing the magnesium in their PCR's?" And the answer was - of course, every lab as a matter of course does this. I reported what they said...I was not reporting my opinion. I don't know enough about PCR optimization to do that.
  19. kurt

    kurt Senior Member

    Messages:
    1,132
    Likes:
    173
    USA.Earth
    Three decades? I can not even find her dissertation online, no reference anywhere. It appears she was in a doctoral program at GWU in 1995, they list a pub with her as a co-author. I can't find the year of her PhD anywhere, but suspect she worked at doctoral level for maybe 15 years. WPI says she worked for NCI for 20 years, but some of that must have been as a grad student. Anyway, this is a minor point, I am now curious why her dissertation is not listed anywhere. Maybe someone else can find that.

    Anyway, I just watched the part of her presentation that described possible reasons for disparity in XMRV detection (presented on 1/17/11), from that link omerbasket posted, and there was no data presented. Just her statement that their test was better. Maybe she gives data later, don't have time now to watch the whole hour...

    The data I would look for, lists of sequences their test can find vs sequences the others can find, and level of overlap between the sequences for each test. This is apparently critical if you are looking for a wider range of sequences, there must be a lot of overlap (areas in the genome where all the strains being tested for have identical sequences). The pol sequences (conserved portion) used by the negative studies tend to have more overlap among tested strains than the gag sequences used by WPI. That is what is at issue, and I believe may be the crux of the whole matter, everything else depends on this.

    If these tests were not calibrated, then this issue would be moot. But with all the tests having been calibrated to the same reference sequence (VP62), this question about the range of calibrated sequences each test design can find is in fact the elephant in the room.

    And for the record, the other 'possible reasons' she mentions in that presentation can all go either way, her presentation was not very convincing.

    -high level of sequence diversity. no data presented, this issue has NOT been successfully dealt with, at least I can find no data, and to the contrary, using gag instead of pol reduces probable diversity according to the experts I have spoken with. If someone can show me information to the contrary, I will consider that of course.

    -patient selection. not an issue, several studies have had the 'sickest of the sick' patients in the cohort. And the Cooperative study, contrary to what has been stated here and elsewhere, had a PEM and CCC requirement, they tested very real, sick CFS patients.

    -worldwide distribution. definitely not an issue, again, the negative studies are from all over, and multiple areas of the US.

    -peripheral blood lymphocytes and prostate not a reservoir. I can't believe she actually said that. This issue would invalidate her Science article. Definitely, XMRV must be found in the blood or there is no way she would have found it by PCR in PBMCs.

    -False positives due to contamination with mouse. She stated they were thorough. Well, according to the experts (other pubs etc) there was more they could have done. They did not test for human cell line contamination in their reagents for example (would have no mouse DNA), and there are several important tests for contamination that have been published since the Science article they definitely have not reported running (yet).
  20. August59

    August59 Daughters High School Graduation

    Messages:
    1,473
    Likes:
    389
    Upstate SC, USA
    Just a question and this seemed like at good place to ask it!

    I think during the blood working group meeting there was some "conversation" that centered around getting differing results depending on which "PCR machine" was used. Has anyone researched this to see if actually using a different PCR machine manufacturer derived at different results on identical samples?

    Thanks

See more popular forum discussions.

Share This Page